This page is part of the FHIR Specification (v3.3.0: R4 Ballot 2). The current version which supercedes this version is 5.0.0.  For a full list of available versions, see the Directory of published versions 
. Page versions: R4 R3
| Orders and Observations Work Group | Maturity Level: N/A | Ballot Status: Informative | Compartments: Device, Encounter, Patient, Practitioner | 
An example of a HLA genotyping results report
@prefix fhir: <http://hl7.org/fhir/> .
@prefix loinc: <http://loinc.org/rdf#> .
@prefix owl: <http://www.w3.org/2002/07/owl#> .
@prefix rdfs: <http://www.w3.org/2000/01/rdf-schema#> .
@prefix xsd: <http://www.w3.org/2001/XMLSchema#> .
# - resource -------------------------------------------------------------------
<http://hl7.org/fhir/Bundle/hla-1> a fhir:Bundle;
  fhir:nodeRole fhir:treeRoot;
  fhir:Resource.id [ fhir:value "hla-1"];
  fhir:Bundle.type [ fhir:value "transaction"];
  fhir:Bundle.entry [
     fhir:index 0;
     fhir:Bundle.entry.fullUrl [ fhir:value "urn:uuid:b0a4b18e-94e7-4b1b-8031-c7ae4bdd8db9" ];
     fhir:Bundle.entry.resource <urn:uuid:b0a4b18e-94e7-4b1b-8031-c7ae4bdd8db9>;
     fhir:Bundle.entry.request [
       fhir:Bundle.entry.request.method [ fhir:value "POST" ];
       fhir:Bundle.entry.request.url [ fhir:value "DiagnosticReport" ]
     ]
  ], [
     fhir:index 1;
     fhir:Bundle.entry.fullUrl [ fhir:value "urn:uuid:8200dab6-18a2-4550-b913-a7db480c0804" ];
     fhir:Bundle.entry.resource <urn:uuid:8200dab6-18a2-4550-b913-a7db480c0804>;
     fhir:Bundle.entry.request [
       fhir:Bundle.entry.request.method [ fhir:value "POST" ];
       fhir:Bundle.entry.request.url [ fhir:value "Sequence" ]
     ]
  ], [
     fhir:index 2;
     fhir:Bundle.entry.fullUrl [ fhir:value "urn:uuid:7c393185-f15c-45bc-a714-c0fdbea32675" ];
     fhir:Bundle.entry.resource <urn:uuid:7c393185-f15c-45bc-a714-c0fdbea32675>;
     fhir:Bundle.entry.request [
       fhir:Bundle.entry.request.method [ fhir:value "POST" ];
       fhir:Bundle.entry.request.url [ fhir:value "Sequence" ]
     ]
  ], [
     fhir:index 3;
     fhir:Bundle.entry.fullUrl [ fhir:value "urn:uuid:65c85f14-c3a0-4b72-818f-820e04fcc621" ];
     fhir:Bundle.entry.resource <urn:uuid:65c85f14-c3a0-4b72-818f-820e04fcc621>;
     fhir:Bundle.entry.request [
       fhir:Bundle.entry.request.method [ fhir:value "POST" ];
       fhir:Bundle.entry.request.url [ fhir:value "Sequence" ]
     ]
  ], [
     fhir:index 4;
     fhir:Bundle.entry.fullUrl [ fhir:value "urn:uuid:fbba9fe7-0ece-4ec1-9233-a437a8d242a0" ];
     fhir:Bundle.entry.resource <urn:uuid:fbba9fe7-0ece-4ec1-9233-a437a8d242a0>;
     fhir:Bundle.entry.request [
       fhir:Bundle.entry.request.method [ fhir:value "POST" ];
       fhir:Bundle.entry.request.url [ fhir:value "Sequence" ]
     ]
  ], [
     fhir:index 5;
     fhir:Bundle.entry.fullUrl [ fhir:value "urn:uuid:cbabf93e-1b4b-46f2-ba1e-d84862670670" ];
     fhir:Bundle.entry.resource <urn:uuid:cbabf93e-1b4b-46f2-ba1e-d84862670670>;
     fhir:Bundle.entry.request [
       fhir:Bundle.entry.request.method [ fhir:value "POST" ];
       fhir:Bundle.entry.request.url [ fhir:value "Sequence" ]
     ]
  ], [
     fhir:index 6;
     fhir:Bundle.entry.fullUrl [ fhir:value "urn:uuid:c233ad3d-1572-48d6-93da-0a583535e138" ];
     fhir:Bundle.entry.resource <urn:uuid:c233ad3d-1572-48d6-93da-0a583535e138>;
     fhir:Bundle.entry.request [
       fhir:Bundle.entry.request.method [ fhir:value "POST" ];
       fhir:Bundle.entry.request.url [ fhir:value "Sequence" ]
     ]
  ], [
     fhir:index 7;
     fhir:Bundle.entry.fullUrl [ fhir:value "urn:uuid:05fa52d7-5c67-460a-8722-d3460b24d6fe" ];
     fhir:Bundle.entry.resource <urn:uuid:05fa52d7-5c67-460a-8722-d3460b24d6fe>;
     fhir:Bundle.entry.request [
       fhir:Bundle.entry.request.method [ fhir:value "POST" ];
       fhir:Bundle.entry.request.url [ fhir:value "Sequence" ]
     ]
  ], [
     fhir:index 8;
     fhir:Bundle.entry.fullUrl [ fhir:value "urn:uuid:db69e549-6267-4777-b4b9-8813f3329309" ];
     fhir:Bundle.entry.resource <urn:uuid:db69e549-6267-4777-b4b9-8813f3329309>;
     fhir:Bundle.entry.request [
       fhir:Bundle.entry.request.method [ fhir:value "POST" ];
       fhir:Bundle.entry.request.url [ fhir:value "Sequence" ]
     ]
  ], [
     fhir:index 9;
     fhir:Bundle.entry.fullUrl [ fhir:value "urn:uuid:bb55c2bc-5ad2-4bc1-8ff3-c407d06b12d0" ];
     fhir:Bundle.entry.resource <urn:uuid:bb55c2bc-5ad2-4bc1-8ff3-c407d06b12d0>;
     fhir:Bundle.entry.request [
       fhir:Bundle.entry.request.method [ fhir:value "POST" ];
       fhir:Bundle.entry.request.url [ fhir:value "Sequence" ]
     ]
  ], [
     fhir:index 10;
     fhir:Bundle.entry.fullUrl [ fhir:value "urn:uuid:46938bb2-0486-4e87-bfd3-89aab2d5e22f" ];
     fhir:Bundle.entry.resource <urn:uuid:46938bb2-0486-4e87-bfd3-89aab2d5e22f>;
     fhir:Bundle.entry.request [
       fhir:Bundle.entry.request.method [ fhir:value "POST" ];
       fhir:Bundle.entry.request.url [ fhir:value "Sequence" ]
     ]
  ], [
     fhir:index 11;
     fhir:Bundle.entry.fullUrl [ fhir:value "urn:uuid:2ae2ff34-279e-43c2-9018-b054fd3fc1ce" ];
     fhir:Bundle.entry.resource <urn:uuid:2ae2ff34-279e-43c2-9018-b054fd3fc1ce>;
     fhir:Bundle.entry.request [
       fhir:Bundle.entry.request.method [ fhir:value "POST" ];
       fhir:Bundle.entry.request.url [ fhir:value "Sequence" ]
     ]
  ], [
     fhir:index 12;
     fhir:Bundle.entry.fullUrl [ fhir:value "urn:uuid:19153ef1-68c6-47a2-9676-c4eefbd39af9" ];
     fhir:Bundle.entry.resource <urn:uuid:19153ef1-68c6-47a2-9676-c4eefbd39af9>;
     fhir:Bundle.entry.request [
       fhir:Bundle.entry.request.method [ fhir:value "POST" ];
       fhir:Bundle.entry.request.url [ fhir:value "Sequence" ]
     ]
  ], [
     fhir:index 13;
     fhir:Bundle.entry.fullUrl [ fhir:value "urn:uuid:b7765bbf-df40-486a-9f2f-404309643de6" ];
     fhir:Bundle.entry.resource <urn:uuid:b7765bbf-df40-486a-9f2f-404309643de6>;
     fhir:Bundle.entry.request [
       fhir:Bundle.entry.request.method [ fhir:value "POST" ];
       fhir:Bundle.entry.request.url [ fhir:value "Observation" ]
     ]
  ], [
     fhir:index 14;
     fhir:Bundle.entry.fullUrl [ fhir:value "urn:uuid:d98d92a7-0e86-4ae5-b036-b7e1bba6ec32" ];
     fhir:Bundle.entry.resource <urn:uuid:d98d92a7-0e86-4ae5-b036-b7e1bba6ec32>;
     fhir:Bundle.entry.request [
       fhir:Bundle.entry.request.method [ fhir:value "POST" ];
       fhir:Bundle.entry.request.url [ fhir:value "Observation" ]
     ]
  ], [
     fhir:index 15;
     fhir:Bundle.entry.fullUrl [ fhir:value "urn:uuid:49a86246-4004-42eb-9bdc-f542f93f9228" ];
     fhir:Bundle.entry.resource <urn:uuid:49a86246-4004-42eb-9bdc-f542f93f9228>;
     fhir:Bundle.entry.request [
       fhir:Bundle.entry.request.method [ fhir:value "POST" ];
       fhir:Bundle.entry.request.url [ fhir:value "Observation" ]
     ]
  ], [
     fhir:index 16;
     fhir:Bundle.entry.fullUrl [ fhir:value "urn:uuid:e2092243-2970-49d2-a90f-b90d1d49715a" ];
     fhir:Bundle.entry.resource <urn:uuid:e2092243-2970-49d2-a90f-b90d1d49715a>;
     fhir:Bundle.entry.request [
       fhir:Bundle.entry.request.method [ fhir:value "POST" ];
       fhir:Bundle.entry.request.url [ fhir:value "Observation" ]
     ]
  ], [
     fhir:index 17;
     fhir:Bundle.entry.fullUrl [ fhir:value "urn:uuid:792be53e-d4fb-4887-a367-815ef6c706e5" ];
     fhir:Bundle.entry.resource <urn:uuid:792be53e-d4fb-4887-a367-815ef6c706e5>;
     fhir:Bundle.entry.request [
       fhir:Bundle.entry.request.method [ fhir:value "POST" ];
       fhir:Bundle.entry.request.url [ fhir:value "Observation" ]
     ]
  ], [
     fhir:index 18;
     fhir:Bundle.entry.fullUrl [ fhir:value "urn:uuid:60613a43-c4cb-4502-b3e2-cf9215feaa70" ];
     fhir:Bundle.entry.resource <urn:uuid:60613a43-c4cb-4502-b3e2-cf9215feaa70>;
     fhir:Bundle.entry.request [
       fhir:Bundle.entry.request.method [ fhir:value "POST" ];
       fhir:Bundle.entry.request.url [ fhir:value "Observation" ]
     ]
  ], [
     fhir:index 19;
     fhir:Bundle.entry.fullUrl [ fhir:value "urn:uuid:709c5315-9403-4867-9d82-0b953836665f" ];
     fhir:Bundle.entry.resource <urn:uuid:709c5315-9403-4867-9d82-0b953836665f>;
     fhir:Bundle.entry.request [
       fhir:Bundle.entry.request.method [ fhir:value "POST" ];
       fhir:Bundle.entry.request.url [ fhir:value "Observation" ]
     ]
  ], [
     fhir:index 20;
     fhir:Bundle.entry.fullUrl [ fhir:value "urn:uuid:8b2aa21c-1426-4717-8ab0-a84d83df7d47" ];
     fhir:Bundle.entry.resource <urn:uuid:8b2aa21c-1426-4717-8ab0-a84d83df7d47>;
     fhir:Bundle.entry.request [
       fhir:Bundle.entry.request.method [ fhir:value "POST" ];
       fhir:Bundle.entry.request.url [ fhir:value "Observation" ]
     ]
  ], [
     fhir:index 21;
     fhir:Bundle.entry.fullUrl [ fhir:value "urn:uuid:0e0a780e-4486-4cd0-bfae-7243c579f208" ];
     fhir:Bundle.entry.resource <urn:uuid:0e0a780e-4486-4cd0-bfae-7243c579f208>;
     fhir:Bundle.entry.request [
       fhir:Bundle.entry.request.method [ fhir:value "POST" ];
       fhir:Bundle.entry.request.url [ fhir:value "Observation" ]
     ]
  ] .
<urn:uuid:b0a4b18e-94e7-4b1b-8031-c7ae4bdd8db9> a fhir:DiagnosticReport;
  fhir:DomainResource.text [
     fhir:Narrative.status [ fhir:value "generated" ];
     fhir:Narrative.div "<div xmlns=\"http://www.w3.org/1999/xhtml\">\n						<h3>HLA-A,-B,-C genotyping report for Mary Chalmers (MRN:12345)</h3>\n						<pre>\n  LOCUS   ALLELE 1            ALLELE 2\n  HLA-A   HLA-A:01:01G        HLA-A*01:02\n  HLA-B   HLA-B*15:01:01G     HLA-B*57:01:01G\n  HLA-C   HLA-C*01:02:01G     HLA-C*03:04:01G\n                </pre>\n						<p>Allele assignments based on IMGT/HLA 3.23</p>\n						<p>Effective date: 2015-12-15</p>\n						<p>Method: Sequencing of exons 2 and 3 of HLA Class I genes</p>\n						<p>Lab: aTypingLab Inc</p>\n						<p>Note: Please refer the <a href=\"genomics.html#hla\">implementation guide </a> for more explanation on this\n                carefully organized bundle example.</p>\n						<pre>\n  Bob Milius - NMDP - 2016-12-01\n\n  Transaction bundle that creates and links:\n  + DiagnosticReport summarizing genotyping for HLA-A,-B,-C typing of patient(donor)\n  + Obervations for each genotype\n  + Observations for each allele\n  + Sequences for exons 2 and 3 for HLA-A,-B, -C\n\n  The endpoints of the following resources are hardcoded into this transaction bundle\n  because these are presumed to already exist when developing the DiagnosticRequest\n  which was to generate this report bundle:\n\n  Patient/119 (potential donor)\n  Specimen/120 (buccal swab)\n  Organization/68  (typing lab)\n  ServiceRequest/123  (report is based on this request)\n                </pre>\n					</div>"
  ];
  fhir:DomainResource.extension [
     fhir:index 0;
     fhir:Extension.url [ fhir:value "http://hl7.org/fhir/StructureDefinition/hla-genotyping-results-allele-database" ];
     fhir:Extension.valueCodeableConcept [
       fhir:CodeableConcept.coding [
         fhir:index 0;
         fhir:Coding.system [ fhir:value "http://www.ebi.ac.uk/ipd/imgt/hla" ];
         fhir:Coding.version [ fhir:value "3.23" ]
       ];
       fhir:CodeableConcept.text [ fhir:value "IMGT/HLA 3.23" ]
     ]
  ], [
     fhir:index 1;
     fhir:Extension.url [ fhir:value "http://hl7.org/fhir/StructureDefinition/hla-genotyping-results-glstring" ];
     fhir:Element.extension [
       fhir:index 0;
       fhir:Extension.url [ fhir:value "text" ];
       fhir:Extension.valueString [ fhir:value "HLA-A:01:01G+HLA-A*01:02^HLA-B*15:01:01:01+HLA-B*57:01:01^HLA-C*01:02:01+HLA-C*03:04:01:01" ]
     ], [
       fhir:index 1;
       fhir:Extension.url [ fhir:value "uri" ];
       fhir:Extension.valueUri [ fhir:value "https://gl.nmdp.org/imgt-hla/3.23.0/multilocus-unphased-genotype/i" ]
     ]
  ], [
     fhir:index 2;
     fhir:Extension.url [ fhir:value "http://hl7.org/fhir/StructureDefinition/hla-genotyping-results-method" ];
     fhir:Extension.valueCodeableConcept [
       fhir:CodeableConcept.coding [
         fhir:index 0;
         fhir:Coding.system [ fhir:value "http://www.ncbi.nlm.nih.gov/gtr/" ];
         fhir:Coding.code [ fhir:value "GTR000000000.0" ]
       ];
       fhir:CodeableConcept.text [ fhir:value "Next Generation Sequencing of exons 2 and 3 of HLA Class I genes" ]
     ]
  ];
  fhir:DiagnosticReport.basedOn [
     fhir:index 0;
     fhir:link <http://hl7.org/fhir/ServiceRequest/123>;
     fhir:Reference.reference [ fhir:value "ServiceRequest/123" ]
  ];
  fhir:DiagnosticReport.status [ fhir:value "final"];
  fhir:DiagnosticReport.category [
     fhir:CodeableConcept.coding [
       fhir:index 0;
       fhir:Coding.system [ fhir:value "http://hl7.org/fhir/v2/0074" ];
       fhir:Coding.code [ fhir:value "GE" ];
       fhir:Coding.display [ fhir:value "Genetics" ]
     ]
  ];
  fhir:DiagnosticReport.code [
     fhir:CodeableConcept.coding [
       fhir:index 0;
       a loinc:13303-3;
       fhir:Coding.system [ fhir:value "http://loinc.org" ];
       fhir:Coding.code [ fhir:value "13303-3" ];
       fhir:Coding.display [ fhir:value "HLA-A+B+C (class I) [Type]" ]
     ]
  ];
  fhir:DiagnosticReport.subject [
     fhir:link <http://hl7.org/fhir/Patient/119>;
     fhir:Reference.reference [ fhir:value "Patient/119" ];
     fhir:Reference.display [ fhir:value "Mary Chalmers" ]
  ];
  fhir:DiagnosticReport.effectiveDateTime [ fhir:value "2016-12-15"^^xsd:date];
  fhir:DiagnosticReport.issued [ fhir:value "2016-12-15T14:15:30-06:00"^^xsd:dateTime];
  fhir:DiagnosticReport.performer [
     fhir:index 0;
     fhir:link <http://hl7.org/fhir/Organization/68>;
     fhir:Reference.reference [ fhir:value "Organization/68" ];
     fhir:Reference.display [ fhir:value "aTypingLab Inc" ]
  ];
  fhir:DiagnosticReport.specimen [
     fhir:index 0;
     fhir:link <http://hl7.org/fhir/Specimen/67>;
     fhir:Reference.reference [ fhir:value "Specimen/67" ];
     fhir:Reference.display [ fhir:value "buccal swab from Mary Chalmers" ]
  ];
  fhir:DiagnosticReport.result [
     fhir:index 0;
     fhir:Reference.reference [ fhir:value "urn:uuid:49a86246-4004-42eb-9bdc-f542f93f9228" ];
     fhir:Reference.display [ fhir:value "HLA-A: HLA-A:01:01G+HLA-A*01:02" ]
  ], [
     fhir:index 1;
     fhir:Reference.reference [ fhir:value "urn:uuid:60613a43-c4cb-4502-b3e2-cf9215feaa70" ];
     fhir:Reference.display [ fhir:value "HLA-B: HLA-B*15:01:01G+HLA-B*57:01:01G" ]
  ], [
     fhir:index 2;
     fhir:Reference.reference [ fhir:value "urn:uuid:0e0a780e-4486-4cd0-bfae-7243c579f208" ];
     fhir:Reference.display [ fhir:value "HLA-C: HLA-C*01:02:01G+HLA-C*03:04:01G" ]
  ] .
<http://hl7.org/fhir/ServiceRequest/123> a fhir:ServiceRequest .
<http://hl7.org/fhir/Patient/119> a fhir:Patient .
<http://hl7.org/fhir/Organization/68> a fhir:Organization .
<http://hl7.org/fhir/Specimen/67> a fhir:Specimen .
<urn:uuid:8200dab6-18a2-4550-b913-a7db480c0804> a fhir:Sequence;
  fhir:DomainResource.text [
     fhir:Narrative.status [ fhir:value "generated" ];
     fhir:Narrative.div "<div xmlns=\"http://www.w3.org/1999/xhtml\">\n						<pre>"HLA-A*01:01:01:01, exon 2"</pre>\n					</div>"
  ];
  fhir:Sequence.type [ fhir:value "dna"];
  fhir:Sequence.coordinateSystem [ fhir:value "0"^^xsd:integer];
  fhir:Sequence.patient [
     fhir:link <http://hl7.org/fhir/Patient/119>;
     fhir:Reference.reference [ fhir:value "Patient/119" ];
     fhir:Reference.display [ fhir:value "Mary Chalmers" ]
  ];
  fhir:Sequence.specimen [
     fhir:link <http://hl7.org/fhir/Specimen/120>;
     fhir:Reference.reference [ fhir:value "Specimen/120" ];
     fhir:Reference.display [ fhir:value "buccal swab from Mary Chalmers" ]
  ];
  fhir:Sequence.referenceSeq [
     fhir:Sequence.referenceSeq.referenceSeqId [
       fhir:CodeableConcept.coding [
         fhir:index 0;
         fhir:Coding.system [ fhir:value "http://www.ebi.ac.uk/ipd/imgt/hla" ];
         fhir:Coding.version [ fhir:value "3.23" ];
         fhir:Coding.code [ fhir:value "HLA00001" ]
       ];
       fhir:CodeableConcept.text [ fhir:value "HLA-A*01:01:01:01" ]
     ];
     fhir:Sequence.referenceSeq.windowStart [ fhir:value "503"^^xsd:integer ];
     fhir:Sequence.referenceSeq.windowEnd [ fhir:value "773"^^xsd:integer ]
  ];
  fhir:Sequence.observedSeq [ fhir:value "GCTCCCACTCCATGAGGTATTTCTTCACATCCGTGTCCCGGCCCGGCCGCGGGGAGCCCCGCTTCATCGCCGTGGGCTACGTGGACGACACGCAGTTCGTGCGGTTCGACAGCGACGCCGCGAGCCAGAAGATGGAGCCGCGGGCGCCGTGGATAGAGCAGGAGGGGCCGGAGTATTGGGACCAGGAGACACGGAATATGAAGGCCCACTCACAGACTGACCGAGCGAACCTGGGGACCCTGCGCGGCTACTACAACCAGAGCGAGGACG"] .
<http://hl7.org/fhir/Specimen/120> a fhir:Specimen .
<urn:uuid:7c393185-f15c-45bc-a714-c0fdbea32675> a fhir:Sequence;
  fhir:DomainResource.text [
     fhir:Narrative.status [ fhir:value "generated" ];
     fhir:Narrative.div "<div xmlns=\"http://www.w3.org/1999/xhtml\">\n						<pre>"HLA-A*01:01:01:01, exon 3"</pre>\n					</div>"
  ];
  fhir:Sequence.type [ fhir:value "dna"];
  fhir:Sequence.coordinateSystem [ fhir:value "0"^^xsd:integer];
  fhir:Sequence.patient [
     fhir:link <http://hl7.org/fhir/Patient/119>;
     fhir:Reference.reference [ fhir:value "Patient/119" ];
     fhir:Reference.display [ fhir:value "Mary Chalmers" ]
  ];
  fhir:Sequence.specimen [
     fhir:link <http://hl7.org/fhir/Specimen/120>;
     fhir:Reference.reference [ fhir:value "Specimen/120" ];
     fhir:Reference.display [ fhir:value "buccal swab from Mary Chalmers" ]
  ];
  fhir:Sequence.referenceSeq [
     fhir:Sequence.referenceSeq.referenceSeqId [
       fhir:CodeableConcept.coding [
         fhir:index 0;
         fhir:Coding.system [ fhir:value "http://www.ebi.ac.uk/ipd/imgt/hla" ];
         fhir:Coding.version [ fhir:value "3.23" ];
         fhir:Coding.code [ fhir:value "HLA00001" ]
       ];
       fhir:CodeableConcept.text [ fhir:value "HLA-A*01:01:01:01" ]
     ];
     fhir:Sequence.referenceSeq.windowStart [ fhir:value "1014"^^xsd:integer ];
     fhir:Sequence.referenceSeq.windowEnd [ fhir:value "1290"^^xsd:integer ]
  ];
  fhir:Sequence.observedSeq [ fhir:value "GTTCTCACACCATCCAGATAATGTATGGCTGCGACGTGGGGCCGGACGGGCGCTTCCTCCGCGGGTACCGGCAGGACGCCTACGACGGCAAGGATTACATCGCCCTGAACGAGGACCTGCGCTCTTGGACCGCGGCGGACATGGCAGCTCAGATCACCAAGCGCAAGTGGGAGGCGGTCCATGCGGCGGAGCAGCGGAGAGTCTACCTGGAGGGCCGGTGCGTGGACGGGCTCCGCAGATACCTGGAGAACGGGAAGGAGACGCTGCAGCGCACGG"] .
<urn:uuid:65c85f14-c3a0-4b72-818f-820e04fcc621> a fhir:Sequence;
  fhir:DomainResource.text [
     fhir:Narrative.status [ fhir:value "generated" ];
     fhir:Narrative.div "<div xmlns=\"http://www.w3.org/1999/xhtml\">\n						<pre>"HLA-A*01:02, exon 2"</pre>\n					</div>"
  ];
  fhir:Sequence.type [ fhir:value "dna"];
  fhir:Sequence.coordinateSystem [ fhir:value "0"^^xsd:integer];
  fhir:Sequence.patient [
     fhir:link <http://hl7.org/fhir/Patient/119>;
     fhir:Reference.reference [ fhir:value "Patient/119" ];
     fhir:Reference.display [ fhir:value "Mary Chalmers" ]
  ];
  fhir:Sequence.specimen [
     fhir:link <http://hl7.org/fhir/Specimen/120>;
     fhir:Reference.reference [ fhir:value "Specimen/120" ];
     fhir:Reference.display [ fhir:value "buccal swab from Mary Chalmers" ]
  ];
  fhir:Sequence.referenceSeq [
     fhir:Sequence.referenceSeq.referenceSeqId [
       fhir:CodeableConcept.coding [
         fhir:index 0;
         fhir:Coding.system [ fhir:value "http://www.ebi.ac.uk/ipd/imgt/hla" ];
         fhir:Coding.version [ fhir:value "3.23" ];
         fhir:Coding.code [ fhir:value "HLA00002" ]
       ];
       fhir:CodeableConcept.text [ fhir:value "HLA-A*01:02" ]
     ];
     fhir:Sequence.referenceSeq.windowStart [ fhir:value "503"^^xsd:integer ];
     fhir:Sequence.referenceSeq.windowEnd [ fhir:value "773"^^xsd:integer ]
  ];
  fhir:Sequence.observedSeq [ fhir:value "GCTCCCACTCCATGAGGTATTTCTCCACATCCGTGTCCCGGCCCGGCAGTGGAGAGCCCCGCTTCATCGCAGTGGGCTACGTGGACGACACGCAGTTCGTGCGGTTCGACAGCGACGCCGCGAGCCAGAAGATGGAGCCGCGGGCGCCGTGGATAGAGCAGGAGGGGCCGGAGTATTGGGACCAGGAGACACGGAATATGAAGGCCCACTCACAGACTGACCGAGCGAACCTGGGGACCCTGCGCGGCTACTACAACCAGAGCGAGGACG"] .
<urn:uuid:fbba9fe7-0ece-4ec1-9233-a437a8d242a0> a fhir:Sequence;
  fhir:DomainResource.text [
     fhir:Narrative.status [ fhir:value "generated" ];
     fhir:Narrative.div "<div xmlns=\"http://www.w3.org/1999/xhtml\">\n						<pre>"HLA-A*01:02, exon 3"</pre>\n					</div>"
  ];
  fhir:Sequence.type [ fhir:value "dna"];
  fhir:Sequence.coordinateSystem [ fhir:value "0"^^xsd:integer];
  fhir:Sequence.patient [
     fhir:link <http://hl7.org/fhir/Patient/119>;
     fhir:Reference.reference [ fhir:value "Patient/119" ];
     fhir:Reference.display [ fhir:value "Mary Chalmers" ]
  ];
  fhir:Sequence.specimen [
     fhir:link <http://hl7.org/fhir/Specimen/120>;
     fhir:Reference.reference [ fhir:value "Specimen/120" ];
     fhir:Reference.display [ fhir:value "buccal swab from Mary Chalmers" ]
  ];
  fhir:Sequence.referenceSeq [
     fhir:Sequence.referenceSeq.referenceSeqId [
       fhir:CodeableConcept.coding [
         fhir:index 0;
         fhir:Coding.system [ fhir:value "http://www.ebi.ac.uk/ipd/imgt/hla" ];
         fhir:Coding.version [ fhir:value "3.23" ];
         fhir:Coding.code [ fhir:value "HLA00002" ]
       ];
       fhir:CodeableConcept.text [ fhir:value "HLA-A*01:02" ]
     ];
     fhir:Sequence.referenceSeq.windowStart [ fhir:value "1014"^^xsd:integer ];
     fhir:Sequence.referenceSeq.windowEnd [ fhir:value "1290"^^xsd:integer ]
  ];
  fhir:Sequence.observedSeq [ fhir:value "GTTCTCACACCATCCAGATAATGTATGGCTGCGACGTGGGGCCGGACGGGCGCTTCCTCCGCGGGTACCGGCAGGACGCCTACGACGGCAAGGATTACATCGCCCTGAACGAGGACCTGCGCTCTTGGACCGCGGCGGACATGGCAGCTCAGATCACCAAGCGCAAGTGGGAGGCGGTCCATGCGGCGGAGCAGCGGAGAGTCTACCTGGAGGGCCGGTGCGTGGACGGGCTCCGCAGATACCTGGAGAACGGGAAGGAGACGCTGCAGCGCACGG"] .
<urn:uuid:cbabf93e-1b4b-46f2-ba1e-d84862670670> a fhir:Sequence;
  fhir:DomainResource.text [
     fhir:Narrative.status [ fhir:value "generated" ];
     fhir:Narrative.div "<div xmlns=\"http://www.w3.org/1999/xhtml\">\n						<pre>"HLA-B*15:01:01:01, exon 2"</pre>\n					</div>"
  ];
  fhir:Sequence.type [ fhir:value "dna"];
  fhir:Sequence.coordinateSystem [ fhir:value "0"^^xsd:integer];
  fhir:Sequence.patient [
     fhir:link <http://hl7.org/fhir/Patient/119>;
     fhir:Reference.reference [ fhir:value "Patient/119" ];
     fhir:Reference.display [ fhir:value "Mary Chalmers" ]
  ];
  fhir:Sequence.specimen [
     fhir:link <http://hl7.org/fhir/Specimen/120>;
     fhir:Reference.reference [ fhir:value "Specimen/120" ];
     fhir:Reference.display [ fhir:value "buccal swab from Mary Chalmers" ]
  ];
  fhir:Sequence.referenceSeq [
     fhir:Sequence.referenceSeq.referenceSeqId [
       fhir:CodeableConcept.coding [
         fhir:index 0;
         fhir:Coding.system [ fhir:value "http://www.ebi.ac.uk/ipd/imgt/hla" ];
         fhir:Coding.version [ fhir:value "3.23" ];
         fhir:Coding.code [ fhir:value "HLA00162" ]
       ];
       fhir:CodeableConcept.text [ fhir:value "HLA-B*15:01:01:01" ]
     ];
     fhir:Sequence.referenceSeq.windowStart [ fhir:value "486"^^xsd:integer ];
     fhir:Sequence.referenceSeq.windowEnd [ fhir:value "756"^^xsd:integer ]
  ];
  fhir:Sequence.observedSeq [ fhir:value "GCTCCCACTCCATGAGGTATTTCTACACCGCCATGTCCCGGCCCGGCCGCGGGGAGCCCCGCTTCATCGCAGTGGGCTACGTGGACGACACCCAGTTCGTGAGGTTCGACAGCGACGCCGCGAGTCCGAGGATGGCGCCCCGGGCGCCATGGATAGAGCAGGAGGGGCCGGAGTATTGGGACCGGGAGACACAGATCTCCAAGACCAACACACAGACTTACCGAGAGAGCCTGCGGAACCTGCGCGGCTACTACAACCAGAGCGAGGCCG"] .
<urn:uuid:c233ad3d-1572-48d6-93da-0a583535e138> a fhir:Sequence;
  fhir:DomainResource.text [
     fhir:Narrative.status [ fhir:value "generated" ];
     fhir:Narrative.div "<div xmlns=\"http://www.w3.org/1999/xhtml\">\n						<pre>"HLA-B*15:01:01:01, exon 3"</pre>\n					</div>"
  ];
  fhir:Sequence.type [ fhir:value "dna"];
  fhir:Sequence.coordinateSystem [ fhir:value "0"^^xsd:integer];
  fhir:Sequence.patient [
     fhir:link <http://hl7.org/fhir/Patient/119>;
     fhir:Reference.reference [ fhir:value "Patient/119" ];
     fhir:Reference.display [ fhir:value "Mary Chalmers" ]
  ];
  fhir:Sequence.specimen [
     fhir:link <http://hl7.org/fhir/Specimen/120>;
     fhir:Reference.reference [ fhir:value "Specimen/120" ];
     fhir:Reference.display [ fhir:value "buccal swab from Mary Chalmers" ]
  ];
  fhir:Sequence.referenceSeq [
     fhir:Sequence.referenceSeq.referenceSeqId [
       fhir:CodeableConcept.coding [
         fhir:index 0;
         fhir:Coding.system [ fhir:value "http://www.ebi.ac.uk/ipd/imgt/hla" ];
         fhir:Coding.version [ fhir:value "3.23" ];
         fhir:Coding.code [ fhir:value "HLA00162" ]
       ];
       fhir:CodeableConcept.text [ fhir:value "HLA-B*15:01:01:01" ]
     ];
     fhir:Sequence.referenceSeq.windowStart [ fhir:value "1001"^^xsd:integer ];
     fhir:Sequence.referenceSeq.windowEnd [ fhir:value "1277"^^xsd:integer ]
  ];
  fhir:Sequence.observedSeq [ fhir:value "GGTCTCACACCCTCCAGAGGATGTACGGCTGCGACGTGGGGCCGGACGGGCGCCTCCTCCGCGGGCATGACCAGTCCGCCTACGACGGCAAGGATTACATCGCCCTGAACGAGGACCTGAGCTCCTGGACCGCGGCGGACACGGCGGCTCAGATCACCCAGCGCAAGTGGGAGGCGGCCCGTGAGGCGGAGCAGTGGAGAGCCTACCTGGAGGGCCTGTGCGTGGAGTGGCTCCGCAGATACCTGGAGAACGGGAAGGAGACGCTGCAGCGCGCGG"] .
<urn:uuid:05fa52d7-5c67-460a-8722-d3460b24d6fe> a fhir:Sequence;
  fhir:DomainResource.text [
     fhir:Narrative.status [ fhir:value "generated" ];
     fhir:Narrative.div "<div xmlns=\"http://www.w3.org/1999/xhtml\">\n						<pre>"HLA-B*57:01:01, exon 2"</pre>\n					</div>"
  ];
  fhir:Sequence.type [ fhir:value "dna"];
  fhir:Sequence.coordinateSystem [ fhir:value "0"^^xsd:integer];
  fhir:Sequence.patient [
     fhir:link <http://hl7.org/fhir/Patient/119>;
     fhir:Reference.reference [ fhir:value "Patient/119" ];
     fhir:Reference.display [ fhir:value "Mary Chalmers" ]
  ];
  fhir:Sequence.specimen [
     fhir:link <http://hl7.org/fhir/Specimen/120>;
     fhir:Reference.reference [ fhir:value "Specimen/120" ];
     fhir:Reference.display [ fhir:value "buccal swab from Mary Chalmers" ]
  ];
  fhir:Sequence.referenceSeq [
     fhir:Sequence.referenceSeq.referenceSeqId [
       fhir:CodeableConcept.coding [
         fhir:index 0;
         fhir:Coding.system [ fhir:value "http://www.ebi.ac.uk/ipd/imgt/hla" ];
         fhir:Coding.version [ fhir:value "3.23" ];
         fhir:Coding.code [ fhir:value "HLA00381" ]
       ];
       fhir:CodeableConcept.text [ fhir:value "HLA-B*57:01:01" ]
     ];
     fhir:Sequence.referenceSeq.windowStart [ fhir:value "485"^^xsd:integer ];
     fhir:Sequence.referenceSeq.windowEnd [ fhir:value "755"^^xsd:integer ]
  ];
  fhir:Sequence.observedSeq [ fhir:value "GCTCCCACTCCATGAGGTATTTCTACACCGCCATGTCCCGGCCCGGCCGCGGGGAGCCCCGCTTCATCGCAGTGGGCTACGTGGACGACACCCAGTTCGTGAGGTTCGACAGCGACGCCGCGAGTCCGAGGATGGCGCCCCGGGCGCCATGGATAGAGCAGGAGGGGCCGGAGTATTGGGACGGGGAGACACGGAACATGAAGGCCTCCGCGCAGACTTACCGAGAGAACCTGCGGATCGCGCTCCGCTACTACAACCAGAGCGAGGCCG"] .
<urn:uuid:db69e549-6267-4777-b4b9-8813f3329309> a fhir:Sequence;
  fhir:DomainResource.text [
     fhir:Narrative.status [ fhir:value "generated" ];
     fhir:Narrative.div "<div xmlns=\"http://www.w3.org/1999/xhtml\">\n						<pre>"HLA-B*57:01:01, exon 3"</pre>\n					</div>"
  ];
  fhir:Sequence.type [ fhir:value "dna"];
  fhir:Sequence.coordinateSystem [ fhir:value "0"^^xsd:integer];
  fhir:Sequence.patient [
     fhir:link <http://hl7.org/fhir/Patient/119>;
     fhir:Reference.reference [ fhir:value "Patient/119" ];
     fhir:Reference.display [ fhir:value "Mary Chalmers" ]
  ];
  fhir:Sequence.specimen [
     fhir:link <http://hl7.org/fhir/Specimen/120>;
     fhir:Reference.reference [ fhir:value "Specimen/120" ];
     fhir:Reference.display [ fhir:value "buccal swab from Mary Chalmers" ]
  ];
  fhir:Sequence.referenceSeq [
     fhir:Sequence.referenceSeq.referenceSeqId [
       fhir:CodeableConcept.coding [
         fhir:index 0;
         fhir:Coding.system [ fhir:value "http://www.ebi.ac.uk/ipd/imgt/hla" ];
         fhir:Coding.version [ fhir:value "3.23" ];
         fhir:Coding.code [ fhir:value "HLA00381" ]
       ];
       fhir:CodeableConcept.text [ fhir:value "HLA-B*57:01:01" ]
     ];
     fhir:Sequence.referenceSeq.windowStart [ fhir:value "1001"^^xsd:integer ];
     fhir:Sequence.referenceSeq.windowEnd [ fhir:value "1277"^^xsd:integer ]
  ];
  fhir:Sequence.observedSeq [ fhir:value "GGTCTCACATCATCCAGGTGATGTATGGCTGCGACGTGGGGCCGGACGGGCGCCTCCTCCGCGGGCATGACCAGTCCGCCTACGACGGCAAGGATTACATCGCCCTGAACGAGGACCTGAGCTCCTGGACCGCGGCGGACACGGCGGCTCAGATCACCCAGCGCAAGTGGGAGGCGGCCCGTGTGGCGGAGCAGCTGAGAGCCTACCTGGAGGGCCTGTGCGTGGAGTGGCTCCGCAGATACCTGGAGAACGGGAAGGAGACGCTGCAGCGCGCGG"] .
<urn:uuid:bb55c2bc-5ad2-4bc1-8ff3-c407d06b12d0> a fhir:Sequence;
  fhir:DomainResource.text [
     fhir:Narrative.status [ fhir:value "generated" ];
     fhir:Narrative.div "<div xmlns=\"http://www.w3.org/1999/xhtml\">\n						<pre>"HLA-C*01:02:01, exon 2"</pre>\n					</div>"
  ];
  fhir:Sequence.type [ fhir:value "dna"];
  fhir:Sequence.coordinateSystem [ fhir:value "0"^^xsd:integer];
  fhir:Sequence.patient [
     fhir:link <http://hl7.org/fhir/Patient/119>;
     fhir:Reference.reference [ fhir:value "Patient/119" ];
     fhir:Reference.display [ fhir:value "Mary Chalmers" ]
  ];
  fhir:Sequence.specimen [
     fhir:link <http://hl7.org/fhir/Specimen/120>;
     fhir:Reference.reference [ fhir:value "Specimen/120" ];
     fhir:Reference.display [ fhir:value "buccal swab from Mary Chalmers" ]
  ];
  fhir:Sequence.referenceSeq [
     fhir:Sequence.referenceSeq.referenceSeqId [
       fhir:CodeableConcept.coding [
         fhir:index 0;
         fhir:Coding.system [ fhir:value "http://www.ebi.ac.uk/ipd/imgt/hla" ];
         fhir:Coding.version [ fhir:value "3.23" ];
         fhir:Coding.code [ fhir:value "HLA00401" ]
       ];
       fhir:CodeableConcept.text [ fhir:value "HLA-C*01:02:01" ]
     ];
     fhir:Sequence.referenceSeq.windowStart [ fhir:value "486"^^xsd:integer ];
     fhir:Sequence.referenceSeq.windowEnd [ fhir:value "756"^^xsd:integer ]
  ];
  fhir:Sequence.observedSeq [ fhir:value "GCTCCCACTCCATGAAGTATTTCTTCACATCCGTGTCCCGGCCTGGCCGCGGAGAGCCCCGCTTCATCTCAGTGGGCTACGTGGACGACACGCAGTTCGTGCGGTTCGACAGCGACGCCGCGAGTCCGAGAGGGGAGCCGCGGGCGCCGTGGGTGGAGCAGGAGGGGCCGGAGTATTGGGACCGGGAGACACAGAAGTACAAGCGCCAGGCACAGACTGACCGAGTGAGCCTGCGGAACCTGCGCGGCTACTACAACCAGAGCGAGGCCG"] .
<urn:uuid:46938bb2-0486-4e87-bfd3-89aab2d5e22f> a fhir:Sequence;
  fhir:DomainResource.text [
     fhir:Narrative.status [ fhir:value "generated" ];
     fhir:Narrative.div "<div xmlns=\"http://www.w3.org/1999/xhtml\">\n						<pre>"HLA-C*01:02:01, exon 3"</pre>\n					</div>"
  ];
  fhir:Sequence.type [ fhir:value "dna"];
  fhir:Sequence.coordinateSystem [ fhir:value "0"^^xsd:integer];
  fhir:Sequence.patient [
     fhir:link <http://hl7.org/fhir/Patient/119>;
     fhir:Reference.reference [ fhir:value "Patient/119" ];
     fhir:Reference.display [ fhir:value "Mary Chalmers" ]
  ];
  fhir:Sequence.specimen [
     fhir:link <http://hl7.org/fhir/Specimen/120>;
     fhir:Reference.reference [ fhir:value "Specimen/120" ];
     fhir:Reference.display [ fhir:value "buccal swab from Mary Chalmers" ]
  ];
  fhir:Sequence.referenceSeq [
     fhir:Sequence.referenceSeq.referenceSeqId [
       fhir:CodeableConcept.coding [
         fhir:index 0;
         fhir:Coding.system [ fhir:value "http://www.ebi.ac.uk/ipd/imgt/hla" ];
         fhir:Coding.version [ fhir:value "3.23" ];
         fhir:Coding.code [ fhir:value "HLA00401" ]
       ];
       fhir:CodeableConcept.text [ fhir:value "HLA-C*01:02:01" ]
     ];
     fhir:Sequence.referenceSeq.windowStart [ fhir:value "1002"^^xsd:integer ];
     fhir:Sequence.referenceSeq.windowEnd [ fhir:value "1278"^^xsd:integer ]
  ];
  fhir:Sequence.observedSeq [ fhir:value "GGTCTCACACCCTCCAGTGGATGTGTGGCTGCGACCTGGGGCCCGACGGGCGCCTCCTCCGCGGGTATGACCAGTACGCCTACGACGGCAAGGATTACATCGCCCTGAACGAGGACCTGCGCTCCTGGACCGCCGCGGACACCGCGGCTCAGATCACCCAGCGCAAGTGGGAGGCGGCCCGTGAGGCGGAGCAGCGGAGAGCCTACCTGGAGGGCACGTGCGTGGAGTGGCTCCGCAGATACCTGGAGAACGGGAAGGAGACGCTGCAGCGCGCGG"] .
<urn:uuid:2ae2ff34-279e-43c2-9018-b054fd3fc1ce> a fhir:Sequence;
  fhir:DomainResource.text [
     fhir:Narrative.status [ fhir:value "generated" ];
     fhir:Narrative.div "<div xmlns=\"http://www.w3.org/1999/xhtml\">\n						<pre>"HLA-C*03:04:01:01, exon 2"</pre>\n					</div>"
  ];
  fhir:Sequence.type [ fhir:value "dna"];
  fhir:Sequence.coordinateSystem [ fhir:value "0"^^xsd:integer];
  fhir:Sequence.patient [
     fhir:link <http://hl7.org/fhir/Patient/119>;
     fhir:Reference.reference [ fhir:value "Patient/119" ];
     fhir:Reference.display [ fhir:value "Mary Chalmers" ]
  ];
  fhir:Sequence.specimen [
     fhir:link <http://hl7.org/fhir/Specimen/120>;
     fhir:Reference.reference [ fhir:value "Specimen/120" ];
     fhir:Reference.display [ fhir:value "buccal swab from Mary Chalmers" ]
  ];
  fhir:Sequence.referenceSeq [
     fhir:Sequence.referenceSeq.referenceSeqId [
       fhir:CodeableConcept.coding [
         fhir:index 0;
         fhir:Coding.system [ fhir:value "http://www.ebi.ac.uk/ipd/imgt/hla" ];
         fhir:Coding.version [ fhir:value "3.23" ];
         fhir:Coding.code [ fhir:value "HLA00413" ]
       ];
       fhir:CodeableConcept.text [ fhir:value "HLA-C*03:04:01:01" ]
     ];
     fhir:Sequence.referenceSeq.windowStart [ fhir:value "486"^^xsd:integer ];
     fhir:Sequence.referenceSeq.windowEnd [ fhir:value "756"^^xsd:integer ]
  ];
  fhir:Sequence.observedSeq [ fhir:value "GCTCCCACTCCATGAGGTATTTCTACACCGCTGTGTCCCGGCCCGGCCGCGGGGAGCCCCACTTCATCGCAGTGGGCTACGTGGACGACACGCAGTTCGTGCGGTTCGACAGCGACGCCGCGAGTCCGAGAGGGGAGCCGCGGGCGCCGTGGGTGGAGCAGGAGGGGCCGGAGTATTGGGACCGGGAGACACAGAAGTACAAGCGCCAGGCACAGACTGACCGAGTGAGCCTGCGGAACCTGCGCGGCTACTACAACCAGAGCGAGGCCG"] .
<urn:uuid:19153ef1-68c6-47a2-9676-c4eefbd39af9> a fhir:Sequence;
  fhir:DomainResource.text [
     fhir:Narrative.status [ fhir:value "generated" ];
     fhir:Narrative.div "<div xmlns=\"http://www.w3.org/1999/xhtml\">\n						<pre>"HLA-C*03:04:01:01, exon 3"</pre>\n					</div>"
  ];
  fhir:Sequence.type [ fhir:value "dna"];
  fhir:Sequence.coordinateSystem [ fhir:value "0"^^xsd:integer];
  fhir:Sequence.patient [
     fhir:link <http://hl7.org/fhir/Patient/119>;
     fhir:Reference.reference [ fhir:value "Patient/119" ];
     fhir:Reference.display [ fhir:value "Mary Chalmers" ]
  ];
  fhir:Sequence.specimen [
     fhir:link <http://hl7.org/fhir/Specimen/120>;
     fhir:Reference.reference [ fhir:value "Specimen/120" ];
     fhir:Reference.display [ fhir:value "buccal swab from Mary Chalmers" ]
  ];
  fhir:Sequence.referenceSeq [
     fhir:Sequence.referenceSeq.referenceSeqId [
       fhir:CodeableConcept.coding [
         fhir:index 0;
         fhir:Coding.system [ fhir:value "http://www.ebi.ac.uk/ipd/imgt/hla" ];
         fhir:Coding.version [ fhir:value "3.23" ];
         fhir:Coding.code [ fhir:value "HLA00413" ]
       ];
       fhir:CodeableConcept.text [ fhir:value "HLA-C*03:04:01:01" ]
     ];
     fhir:Sequence.referenceSeq.windowStart [ fhir:value "1001"^^xsd:integer ];
     fhir:Sequence.referenceSeq.windowEnd [ fhir:value "1277"^^xsd:integer ]
  ];
  fhir:Sequence.observedSeq [ fhir:value "GGTCTCACATCATCCAGAGGATGTATGGCTGCGACGTGGGGCCCGACGGGCGCCTCCTCCGCGGGTATGACCAGTACGCCTACGACGGCAAGGATTACATCGCCCTGAACGAGGATCTGCGCTCCTGGACCGCCGCGGACACGGCGGCTCAGATCACCCAGCGCAAGTGGGAGGCGGCCCGTGAGGCGGAGCAGCTGAGAGCCTACCTGGAGGGCCTGTGCGTGGAGTGGCTCCGCAGATACCTGAAGAATGGGAAGGAGACGCTGCAGCGCGCGG"] .
<urn:uuid:b7765bbf-df40-486a-9f2f-404309643de6> a fhir:Observation;
  fhir:DomainResource.text [
     fhir:Narrative.status [ fhir:value "generated" ];
     fhir:Narrative.div "<div xmlns=\"http://www.w3.org/1999/xhtml\">\n						<pre>HLA-A:01:01:01G</pre>\n					</div>"
  ];
  fhir:DomainResource.extension [
     fhir:index 0;
     fhir:Extension.url [ fhir:value "http://hl7.org/fhir/StructureDefinition/observation-geneticsGene" ];
     fhir:Extension.valueCodeableConcept [
       fhir:CodeableConcept.coding [
         fhir:index 0;
         fhir:Coding.system [ fhir:value "http://www.genenames.org" ];
         fhir:Coding.code [ fhir:value "HGNC:4931" ];
         fhir:Coding.display [ fhir:value "HLA-A" ]
       ]
     ]
  ], [
     fhir:index 1;
     fhir:Extension.url [ fhir:value "http://hl7.org/fhir/StructureDefinition/observation-geneticsGenomicSourceClass" ];
     fhir:Extension.valueCodeableConcept [
       fhir:CodeableConcept.coding [
         fhir:index 0;
         a loinc:LA6683-2;
         fhir:Coding.system [ fhir:value "http://loinc.org" ];
         fhir:Coding.code [ fhir:value "LA6683-2" ];
         fhir:Coding.display [ fhir:value "germline" ]
       ]
     ]
  ];
  fhir:Observation.status [ fhir:value "final"];
  fhir:Observation.code [
     fhir:CodeableConcept.coding [
       fhir:index 0;
       a loinc:57290-9;
       fhir:Coding.system [ fhir:value "http://loinc.org" ];
       fhir:Coding.code [ fhir:value "57290-9" ];
       fhir:Coding.display [ fhir:value "HLA-A [Type] by High resolution" ]
     ]
  ];
  fhir:Observation.subject [
     fhir:link <http://hl7.org/fhir/Patient/119>;
     fhir:Reference.reference [ fhir:value "Patient/119" ];
     fhir:Reference.display [ fhir:value "Mary Chalmers" ]
  ];
  fhir:Observation.effectiveDateTime [ fhir:value "2016-12-15"^^xsd:date];
  fhir:Observation.specimen [
     fhir:link <http://hl7.org/fhir/Specimen/120>;
     fhir:Reference.reference [ fhir:value "Specimen/120" ];
     fhir:Reference.display [ fhir:value "buccal swab from Mary Chalmers" ]
  ];
  fhir:Observation.derivedFrom [
     fhir:index 0;
     fhir:Reference.reference [ fhir:value "urn:uuid:8200dab6-18a2-4550-b913-a7db480c0804" ];
     fhir:Reference.display [ fhir:value "HLA-A*01:01:01:01, exon 2" ]
  ], [
     fhir:index 1;
     fhir:Reference.reference [ fhir:value "urn:uuid:7c393185-f15c-45bc-a714-c0fdbea32675" ];
     fhir:Reference.display [ fhir:value "HLA-A*01:01:01:01, exon 3" ]
  ] .
<urn:uuid:d98d92a7-0e86-4ae5-b036-b7e1bba6ec32> a fhir:Observation;
  fhir:DomainResource.text [
     fhir:Narrative.status [ fhir:value "generated" ];
     fhir:Narrative.div "<div xmlns=\"http://www.w3.org/1999/xhtml\">\n						<pre>HLA-A*01:02</pre>\n					</div>"
  ];
  fhir:DomainResource.extension [
     fhir:index 0;
     fhir:Extension.url [ fhir:value "http://hl7.org/fhir/StructureDefinition/observation-geneticsGene" ];
     fhir:Extension.valueCodeableConcept [
       fhir:CodeableConcept.coding [
         fhir:index 0;
         fhir:Coding.system [ fhir:value "http://www.genenames.org" ];
         fhir:Coding.code [ fhir:value "HGNC:4931" ];
         fhir:Coding.display [ fhir:value "HLA-A" ]
       ]
     ]
  ], [
     fhir:index 1;
     fhir:Extension.url [ fhir:value "http://hl7.org/fhir/StructureDefinition/observation-geneticsGenomicSourceClass" ];
     fhir:Extension.valueCodeableConcept [
       fhir:CodeableConcept.coding [
         fhir:index 0;
         a loinc:LA6683-2;
         fhir:Coding.system [ fhir:value "http://loinc.org" ];
         fhir:Coding.code [ fhir:value "LA6683-2" ];
         fhir:Coding.display [ fhir:value "germline" ]
       ]
     ]
  ];
  fhir:Observation.status [ fhir:value "final"];
  fhir:Observation.code [
     fhir:CodeableConcept.coding [
       fhir:index 0;
       a loinc:57290-9;
       fhir:Coding.system [ fhir:value "http://loinc.org" ];
       fhir:Coding.code [ fhir:value "57290-9" ];
       fhir:Coding.display [ fhir:value "HLA-A [Type] by High resolution" ]
     ]
  ];
  fhir:Observation.subject [
     fhir:link <http://hl7.org/fhir/Patient/119>;
     fhir:Reference.reference [ fhir:value "Patient/119" ];
     fhir:Reference.display [ fhir:value "Mary Chalmers" ]
  ];
  fhir:Observation.effectiveDateTime [ fhir:value "2016-12-15"^^xsd:date];
  fhir:Observation.specimen [
     fhir:link <http://hl7.org/fhir/Specimen/120>;
     fhir:Reference.reference [ fhir:value "Specimen/120" ];
     fhir:Reference.display [ fhir:value "buccal swab from Mary Chalmers" ]
  ];
  fhir:Observation.derivedFrom [
     fhir:index 0;
     fhir:Reference.reference [ fhir:value "urn:uuid:65c85f14-c3a0-4b72-818f-820e04fcc621" ];
     fhir:Reference.display [ fhir:value "HLA-A*01:02, exon 2" ]
  ], [
     fhir:index 1;
     fhir:Reference.reference [ fhir:value "urn:uuid:fbba9fe7-0ece-4ec1-9233-a437a8d242a0" ];
     fhir:Reference.display [ fhir:value "HLA-A*01:02, exon 3" ]
  ] .
<urn:uuid:49a86246-4004-42eb-9bdc-f542f93f9228> a fhir:Observation;
  fhir:DomainResource.text [
     fhir:Narrative.status [ fhir:value "generated" ];
     fhir:Narrative.div "<div xmlns=\"http://www.w3.org/1999/xhtml\">\n						<pre>HLA-A:01:01G+HLA-A*01:02</pre>\n					</div>"
  ];
  fhir:DomainResource.extension [
     fhir:index 0;
     fhir:Extension.url [ fhir:value "http://hl7.org/fhir/StructureDefinition/observation-geneticsGene" ];
     fhir:Extension.valueCodeableConcept [
       fhir:CodeableConcept.coding [
         fhir:index 0;
         fhir:Coding.system [ fhir:value "http://www.genenames.org" ];
         fhir:Coding.code [ fhir:value "HGNC:4931" ];
         fhir:Coding.display [ fhir:value "HLA-A" ]
       ]
     ]
  ], [
     fhir:index 1;
     fhir:Extension.url [ fhir:value "http://hl7.org/fhir/StructureDefinition/observation-geneticsGenomicSourceClass" ];
     fhir:Extension.valueCodeableConcept [
       fhir:CodeableConcept.coding [
         fhir:index 0;
         a loinc:LA6683-2;
         fhir:Coding.system [ fhir:value "http://loinc.org" ];
         fhir:Coding.code [ fhir:value "LA6683-2" ];
         fhir:Coding.display [ fhir:value "germline" ]
       ]
     ]
  ];
  fhir:Observation.status [ fhir:value "final"];
  fhir:Observation.code [
     fhir:CodeableConcept.coding [
       fhir:index 0;
       a loinc:57290-9;
       fhir:Coding.system [ fhir:value "http://loinc.org" ];
       fhir:Coding.code [ fhir:value "57290-9" ];
       fhir:Coding.display [ fhir:value "HLA-A [Type] by High resolution" ]
     ]
  ];
  fhir:Observation.subject [
     fhir:link <http://hl7.org/fhir/Patient/119>;
     fhir:Reference.reference [ fhir:value "Patient/119" ];
     fhir:Reference.display [ fhir:value "Mary Chalmers" ]
  ];
  fhir:Observation.effectiveDateTime [ fhir:value "2016-12-15"^^xsd:date];
  fhir:Observation.specimen [
     fhir:link <http://hl7.org/fhir/Specimen/120>;
     fhir:Reference.reference [ fhir:value "Specimen/120" ];
     fhir:Reference.display [ fhir:value "buccal swab from Mary Chalmers" ]
  ];
  fhir:Observation.derivedFrom [
     fhir:index 0;
     fhir:Reference.reference [ fhir:value "urn:uuid:b7765bbf-df40-486a-9f2f-404309643de6" ];
     fhir:Reference.display [ fhir:value "HLA-A*01:01:01G, exons 2 and 3" ]
  ], [
     fhir:index 1;
     fhir:Reference.reference [ fhir:value "urn:uuid:d98d92a7-0e86-4ae5-b036-b7e1bba6ec32" ];
     fhir:Reference.display [ fhir:value "HLA-A*01:02, exons 2 and 3" ]
  ] .
<urn:uuid:e2092243-2970-49d2-a90f-b90d1d49715a> a fhir:Observation;
  fhir:DomainResource.text [
     fhir:Narrative.status [ fhir:value "generated" ];
     fhir:Narrative.div "<div xmlns=\"http://www.w3.org/1999/xhtml\">\n						<pre>HLA-B*15:01:01G</pre>\n					</div>"
  ];
  fhir:DomainResource.extension [
     fhir:index 0;
     fhir:Extension.url [ fhir:value "http://hl7.org/fhir/StructureDefinition/observation-geneticsGene" ];
     fhir:Extension.valueCodeableConcept [
       fhir:CodeableConcept.coding [
         fhir:index 0;
         fhir:Coding.system [ fhir:value "http://www.genenames.org" ];
         fhir:Coding.code [ fhir:value "HGNC:4932" ];
         fhir:Coding.display [ fhir:value "HLA-B" ]
       ]
     ]
  ], [
     fhir:index 1;
     fhir:Extension.url [ fhir:value "http://hl7.org/fhir/StructureDefinition/observation-geneticsGenomicSourceClass" ];
     fhir:Extension.valueCodeableConcept [
       fhir:CodeableConcept.coding [
         fhir:index 0;
         a loinc:LA6683-2;
         fhir:Coding.system [ fhir:value "http://loinc.org" ];
         fhir:Coding.code [ fhir:value "LA6683-2" ];
         fhir:Coding.display [ fhir:value "germline" ]
       ]
     ]
  ];
  fhir:Observation.status [ fhir:value "final"];
  fhir:Observation.code [
     fhir:CodeableConcept.coding [
       fhir:index 0;
       a loinc:57291-7;
       fhir:Coding.system [ fhir:value "http://loinc.org" ];
       fhir:Coding.code [ fhir:value "57291-7" ];
       fhir:Coding.display [ fhir:value "HLA-B [Type] by High resolution" ]
     ]
  ];
  fhir:Observation.subject [
     fhir:link <http://hl7.org/fhir/Patient/119>;
     fhir:Reference.reference [ fhir:value "Patient/119" ];
     fhir:Reference.display [ fhir:value "Mary Chalmers" ]
  ];
  fhir:Observation.effectiveDateTime [ fhir:value "2016-12-15"^^xsd:date];
  fhir:Observation.specimen [
     fhir:link <http://hl7.org/fhir/Specimen/120>;
     fhir:Reference.reference [ fhir:value "Specimen/120" ];
     fhir:Reference.display [ fhir:value "buccal swab from Mary Chalmers" ]
  ];
  fhir:Observation.derivedFrom [
     fhir:index 0;
     fhir:Reference.reference [ fhir:value "urn:uuid:cbabf93e-1b4b-46f2-ba1e-d84862670670" ];
     fhir:Reference.display [ fhir:value "HLA-B*15:01:01:01, exon 2" ]
  ], [
     fhir:index 1;
     fhir:Reference.reference [ fhir:value "urn:uuid:c233ad3d-1572-48d6-93da-0a583535e138" ];
     fhir:Reference.display [ fhir:value "HLA-B*15:01:01:01, exon 3" ]
  ] .
<urn:uuid:792be53e-d4fb-4887-a367-815ef6c706e5> a fhir:Observation;
  fhir:DomainResource.text [
     fhir:Narrative.status [ fhir:value "generated" ];
     fhir:Narrative.div "<div xmlns=\"http://www.w3.org/1999/xhtml\">\n						<pre>HLA-B*57:01:01G</pre>\n					</div>"
  ];
  fhir:DomainResource.extension [
     fhir:index 0;
     fhir:Extension.url [ fhir:value "http://hl7.org/fhir/StructureDefinition/observation-geneticsGene" ];
     fhir:Extension.valueCodeableConcept [
       fhir:CodeableConcept.coding [
         fhir:index 0;
         fhir:Coding.system [ fhir:value "http://www.genenames.org" ];
         fhir:Coding.code [ fhir:value "HGNC:4932" ];
         fhir:Coding.display [ fhir:value "HLA-B" ]
       ]
     ]
  ], [
     fhir:index 1;
     fhir:Extension.url [ fhir:value "http://hl7.org/fhir/StructureDefinition/observation-geneticsGenomicSourceClass" ];
     fhir:Extension.valueCodeableConcept [
       fhir:CodeableConcept.coding [
         fhir:index 0;
         a loinc:LA6683-2;
         fhir:Coding.system [ fhir:value "http://loinc.org" ];
         fhir:Coding.code [ fhir:value "LA6683-2" ];
         fhir:Coding.display [ fhir:value "germline" ]
       ]
     ]
  ];
  fhir:Observation.status [ fhir:value "final"];
  fhir:Observation.code [
     fhir:CodeableConcept.coding [
       fhir:index 0;
       a loinc:57291-7;
       fhir:Coding.system [ fhir:value "http://loinc.org" ];
       fhir:Coding.code [ fhir:value "57291-7" ];
       fhir:Coding.display [ fhir:value "HLA-B [Type] by High resolution" ]
     ]
  ];
  fhir:Observation.subject [
     fhir:link <http://hl7.org/fhir/Patient/119>;
     fhir:Reference.reference [ fhir:value "Patient/119" ];
     fhir:Reference.display [ fhir:value "Mary Chalmers" ]
  ];
  fhir:Observation.effectiveDateTime [ fhir:value "2016-12-15"^^xsd:date];
  fhir:Observation.specimen [
     fhir:link <http://hl7.org/fhir/Specimen/120>;
     fhir:Reference.reference [ fhir:value "Specimen/120" ];
     fhir:Reference.display [ fhir:value "buccal swab from Mary Chalmers" ]
  ];
  fhir:Observation.derivedFrom [
     fhir:index 0;
     fhir:Reference.reference [ fhir:value "urn:uuid:05fa52d7-5c67-460a-8722-d3460b24d6fe" ];
     fhir:Reference.display [ fhir:value "HLA-B*57:01:01, exon 2" ]
  ], [
     fhir:index 1;
     fhir:Reference.reference [ fhir:value "urn:uuid:db69e549-6267-4777-b4b9-8813f3329309" ];
     fhir:Reference.display [ fhir:value "HLA-B*57:01:01, exon 3" ]
  ] .
<urn:uuid:60613a43-c4cb-4502-b3e2-cf9215feaa70> a fhir:Observation;
  fhir:DomainResource.text [
     fhir:Narrative.status [ fhir:value "generated" ];
     fhir:Narrative.div "<div xmlns=\"http://www.w3.org/1999/xhtml\">\n						<pre>HLA-B*15:01:01G+HLA-B*57:01:01G</pre>\n					</div>"
  ];
  fhir:DomainResource.extension [
     fhir:index 0;
     fhir:Extension.url [ fhir:value "http://hl7.org/fhir/StructureDefinition/observation-geneticsGene" ];
     fhir:Extension.valueCodeableConcept [
       fhir:CodeableConcept.coding [
         fhir:index 0;
         fhir:Coding.system [ fhir:value "http://www.genenames.org" ];
         fhir:Coding.code [ fhir:value "HGNC:4932" ];
         fhir:Coding.display [ fhir:value "HLA-B" ]
       ]
     ]
  ], [
     fhir:index 1;
     fhir:Extension.url [ fhir:value "http://hl7.org/fhir/StructureDefinition/observation-geneticsGenomicSourceClass" ];
     fhir:Extension.valueCodeableConcept [
       fhir:CodeableConcept.coding [
         fhir:index 0;
         a loinc:LA6683-2;
         fhir:Coding.system [ fhir:value "http://loinc.org" ];
         fhir:Coding.code [ fhir:value "LA6683-2" ];
         fhir:Coding.display [ fhir:value "germline" ]
       ]
     ]
  ];
  fhir:Observation.status [ fhir:value "final"];
  fhir:Observation.code [
     fhir:CodeableConcept.coding [
       fhir:index 0;
       a loinc:57291-7;
       fhir:Coding.system [ fhir:value "http://loinc.org" ];
       fhir:Coding.code [ fhir:value "57291-7" ];
       fhir:Coding.display [ fhir:value "HLA-B [Type] by High resolution" ]
     ]
  ];
  fhir:Observation.subject [
     fhir:link <http://hl7.org/fhir/Patient/119>;
     fhir:Reference.reference [ fhir:value "Patient/119" ];
     fhir:Reference.display [ fhir:value "Mary Chalmers" ]
  ];
  fhir:Observation.effectiveDateTime [ fhir:value "2016-12-15"^^xsd:date];
  fhir:Observation.specimen [
     fhir:link <http://hl7.org/fhir/Specimen/120>;
     fhir:Reference.reference [ fhir:value "Specimen/120" ];
     fhir:Reference.display [ fhir:value "buccal swab from Mary Chalmers" ]
  ];
  fhir:Observation.derivedFrom [
     fhir:index 0;
     fhir:Reference.reference [ fhir:value "urn:uuid:e2092243-2970-49d2-a90f-b90d1d49715a" ];
     fhir:Reference.display [ fhir:value "HLA-B*15:01:01G, exons 2 and 3" ]
  ], [
     fhir:index 1;
     fhir:Reference.reference [ fhir:value "urn:uuid:792be53e-d4fb-4887-a367-815ef6c706e5" ];
     fhir:Reference.display [ fhir:value "HLA-B*57:01:01G, exons 2 and 3" ]
  ] .
<urn:uuid:709c5315-9403-4867-9d82-0b953836665f> a fhir:Observation;
  fhir:DomainResource.text [
     fhir:Narrative.status [ fhir:value "generated" ];
     fhir:Narrative.div "<div xmlns=\"http://www.w3.org/1999/xhtml\">\n						<pre>HLA-C*01:02:01</pre>\n					</div>"
  ];
  fhir:DomainResource.extension [
     fhir:index 0;
     fhir:Extension.url [ fhir:value "http://hl7.org/fhir/StructureDefinition/observation-geneticsGene" ];
     fhir:Extension.valueCodeableConcept [
       fhir:CodeableConcept.coding [
         fhir:index 0;
         fhir:Coding.system [ fhir:value "http://www.genenames.org" ];
         fhir:Coding.code [ fhir:value "HGNC:4933" ];
         fhir:Coding.display [ fhir:value "HLA-C" ]
       ]
     ]
  ], [
     fhir:index 1;
     fhir:Extension.url [ fhir:value "http://hl7.org/fhir/StructureDefinition/observation-geneticsGenomicSourceClass" ];
     fhir:Extension.valueCodeableConcept [
       fhir:CodeableConcept.coding [
         fhir:index 0;
         a loinc:LA6683-2;
         fhir:Coding.system [ fhir:value "http://loinc.org" ];
         fhir:Coding.code [ fhir:value "LA6683-2" ];
         fhir:Coding.display [ fhir:value "germline" ]
       ]
     ]
  ];
  fhir:Observation.status [ fhir:value "final"];
  fhir:Observation.code [
     fhir:CodeableConcept.coding [
       fhir:index 0;
       a loinc:77636-9;
       fhir:Coding.system [ fhir:value "http://loinc.org" ];
       fhir:Coding.code [ fhir:value "77636-9" ];
       fhir:Coding.display [ fhir:value "HLA-C [Type] by High resolution" ]
     ]
  ];
  fhir:Observation.subject [
     fhir:link <http://hl7.org/fhir/Patient/119>;
     fhir:Reference.reference [ fhir:value "Patient/119" ];
     fhir:Reference.display [ fhir:value "Mary Chalmers" ]
  ];
  fhir:Observation.effectiveDateTime [ fhir:value "2016-12-15"^^xsd:date];
  fhir:Observation.specimen [
     fhir:link <http://hl7.org/fhir/Specimen/120>;
     fhir:Reference.reference [ fhir:value "Specimen/120" ];
     fhir:Reference.display [ fhir:value "buccal swab from Mary Chalmers" ]
  ];
  fhir:Observation.derivedFrom [
     fhir:index 0;
     fhir:Reference.reference [ fhir:value "urn:uuid:bb55c2bc-5ad2-4bc1-8ff3-c407d06b12d0" ];
     fhir:Reference.display [ fhir:value "HLA-C*01:02:01, exon 2" ]
  ], [
     fhir:index 1;
     fhir:Reference.reference [ fhir:value "urn:uuid:46938bb2-0486-4e87-bfd3-89aab2d5e22f" ];
     fhir:Reference.display [ fhir:value "HLA-C*01:02:01, exon 3" ]
  ] .
<urn:uuid:8b2aa21c-1426-4717-8ab0-a84d83df7d47> a fhir:Observation;
  fhir:DomainResource.text [
     fhir:Narrative.status [ fhir:value "generated" ];
     fhir:Narrative.div "<div xmlns=\"http://www.w3.org/1999/xhtml\">\n						<pre>HLA-C*03:04:01:01</pre>\n					</div>"
  ];
  fhir:DomainResource.extension [
     fhir:index 0;
     fhir:Extension.url [ fhir:value "http://hl7.org/fhir/StructureDefinition/observation-geneticsGene" ];
     fhir:Extension.valueCodeableConcept [
       fhir:CodeableConcept.coding [
         fhir:index 0;
         fhir:Coding.system [ fhir:value "http://www.genenames.org" ];
         fhir:Coding.code [ fhir:value "HGNC:4933" ];
         fhir:Coding.display [ fhir:value "HLA-C" ]
       ]
     ]
  ], [
     fhir:index 1;
     fhir:Extension.url [ fhir:value "http://hl7.org/fhir/StructureDefinition/observation-geneticsGenomicSourceClass" ];
     fhir:Extension.valueCodeableConcept [
       fhir:CodeableConcept.coding [
         fhir:index 0;
         a loinc:LA6683-2;
         fhir:Coding.system [ fhir:value "http://loinc.org" ];
         fhir:Coding.code [ fhir:value "LA6683-2" ];
         fhir:Coding.display [ fhir:value "germline" ]
       ]
     ]
  ];
  fhir:Observation.status [ fhir:value "final"];
  fhir:Observation.code [
     fhir:CodeableConcept.coding [
       fhir:index 0;
       a loinc:77636-9;
       fhir:Coding.system [ fhir:value "http://loinc.org" ];
       fhir:Coding.code [ fhir:value "77636-9" ];
       fhir:Coding.display [ fhir:value "HLA-C [Type] by High resolution" ]
     ]
  ];
  fhir:Observation.subject [
     fhir:link <http://hl7.org/fhir/Patient/119>;
     fhir:Reference.reference [ fhir:value "Patient/119" ];
     fhir:Reference.display [ fhir:value "Mary Chalmers" ]
  ];
  fhir:Observation.effectiveDateTime [ fhir:value "2016-12-15"^^xsd:date];
  fhir:Observation.specimen [
     fhir:link <http://hl7.org/fhir/Specimen/120>;
     fhir:Reference.reference [ fhir:value "Specimen/120" ];
     fhir:Reference.display [ fhir:value "buccal swab from Mary Chalmers" ]
  ];
  fhir:Observation.derivedFrom [
     fhir:index 0;
     fhir:Reference.reference [ fhir:value "urn:uuid:2ae2ff34-279e-43c2-9018-b054fd3fc1ce" ];
     fhir:Reference.display [ fhir:value "HLA-C*03:04:01:01, exon 2" ]
  ], [
     fhir:index 1;
     fhir:Reference.reference [ fhir:value "urn:uuid:19153ef1-68c6-47a2-9676-c4eefbd39af9" ];
     fhir:Reference.display [ fhir:value "HLA-C*03:04:01:01, exon 3" ]
  ] .
<urn:uuid:0e0a780e-4486-4cd0-bfae-7243c579f208> a fhir:Observation;
  fhir:DomainResource.text [
     fhir:Narrative.status [ fhir:value "generated" ];
     fhir:Narrative.div "<div xmlns=\"http://www.w3.org/1999/xhtml\">\n						<pre>HLA-C*01:02:01G+HLA-C*03:04:01G</pre>\n					</div>"
  ];
  fhir:DomainResource.extension [
     fhir:index 0;
     fhir:Extension.url [ fhir:value "http://hl7.org/fhir/StructureDefinition/observation-geneticsGene" ];
     fhir:Extension.valueCodeableConcept [
       fhir:CodeableConcept.coding [
         fhir:index 0;
         fhir:Coding.system [ fhir:value "http://www.genenames.org" ];
         fhir:Coding.code [ fhir:value "HGNC:4933" ];
         fhir:Coding.display [ fhir:value "HLA-C" ]
       ]
     ]
  ], [
     fhir:index 1;
     fhir:Extension.url [ fhir:value "http://hl7.org/fhir/StructureDefinition/observation-geneticsGenomicSourceClass" ];
     fhir:Extension.valueCodeableConcept [
       fhir:CodeableConcept.coding [
         fhir:index 0;
         a loinc:LA6683-2;
         fhir:Coding.system [ fhir:value "http://loinc.org" ];
         fhir:Coding.code [ fhir:value "LA6683-2" ];
         fhir:Coding.display [ fhir:value "germline" ]
       ]
     ]
  ];
  fhir:Observation.status [ fhir:value "final"];
  fhir:Observation.code [
     fhir:CodeableConcept.coding [
       fhir:index 0;
       a loinc:77636-9;
       fhir:Coding.system [ fhir:value "http://loinc.org" ];
       fhir:Coding.code [ fhir:value "77636-9" ];
       fhir:Coding.display [ fhir:value "HLA-C [Type] by High resolution" ]
     ]
  ];
  fhir:Observation.subject [
     fhir:link <http://hl7.org/fhir/Patient/119>;
     fhir:Reference.reference [ fhir:value "Patient/119" ];
     fhir:Reference.display [ fhir:value "Mary Chalmers" ]
  ];
  fhir:Observation.effectiveDateTime [ fhir:value "2016-12-15"^^xsd:date];
  fhir:Observation.specimen [
     fhir:link <http://hl7.org/fhir/Specimen/120>;
     fhir:Reference.reference [ fhir:value "Specimen/120" ];
     fhir:Reference.display [ fhir:value "buccal swab from Mary Chalmers" ]
  ];
  fhir:Observation.derivedFrom [
     fhir:index 0;
     fhir:Reference.reference [ fhir:value "urn:uuid:709c5315-9403-4867-9d82-0b953836665f" ];
     fhir:Reference.display [ fhir:value "HLA-C*01:02:01G, exons 2 and 3" ]
  ], [
     fhir:index 1;
     fhir:Reference.reference [ fhir:value "urn:uuid:8b2aa21c-1426-4717-8ab0-a84d83df7d47" ];
     fhir:Reference.display [ fhir:value "HLA-C*03:04:01G, exons 2 and 3" ]
  ] .
# - ontology header ------------------------------------------------------------
<http://hl7.org/fhir/Bundle/hla-1.ttl> a owl:Ontology;
  owl:imports fhir:fhir.ttl;
  owl:versionIRI <http://build.fhir.org/Bundle/hla-1.ttl> .
# -------------------------------------------------------------------------------------
Usage note: every effort has been made to ensure that the examples are correct and useful, but they are not a normative part of the specification.