This page is part of the Genetic Reporting Implementation Guide (v0.3.0: STU 1 Ballot 2) based on FHIR R4. The current version which supercedes this version is 2.0.0. For a full list of available versions, see the Directory of published versions 
@prefix fhir: <http://hl7.org/fhir/> . @prefix loinc: <http://loinc.org/rdf#> . @prefix owl: <http://www.w3.org/2002/07/owl#> . @prefix rdfs: <http://www.w3.org/2000/01/rdf-schema#> . @prefix sct: <http://snomed.info/id/> . @prefix xsd: <http://www.w3.org/2001/XMLSchema#> . # - resource ------------------------------------------------------------------- a fhir:Bundle; fhir:nodeRole fhir:treeRoot; fhir:Resource.id [ fhir:value "CG-IG-HLA-FullBundle-01"]; fhir:Bundle.type [ fhir:value "transaction"]; fhir:Bundle.entry [ fhir:index 0; fhir:Bundle.entry.fullUrl [ fhir:value "urn:uuid:13f34265-335c-4853-bc38-0815315edafa" ]; fhir:Bundle.entry.resource <urn:uuid:13f34265-335c-4853-bc38-0815315edafa>; fhir:Bundle.entry.request [ fhir:Bundle.entry.request.method [ fhir:value "POST" ]; fhir:Bundle.entry.request.url [ fhir:value "Patient" ] ] ], [ fhir:index 1; fhir:Bundle.entry.fullUrl [ fhir:value "urn:uuid:e44fbe33-6084-4ae2-a95e-8bc451c63340" ]; fhir:Bundle.entry.resource <urn:uuid:e44fbe33-6084-4ae2-a95e-8bc451c63340>; fhir:Bundle.entry.request [ fhir:Bundle.entry.request.method [ fhir:value "POST" ]; fhir:Bundle.entry.request.url [ fhir:value "Specimen" ] ] ], [ fhir:index 2; fhir:Bundle.entry.fullUrl [ fhir:value "urn:uuid:9243cc20-27bd-4f87-ba90-0328ed474950" ]; fhir:Bundle.entry.resource <urn:uuid:9243cc20-27bd-4f87-ba90-0328ed474950>; fhir:Bundle.entry.request [ fhir:Bundle.entry.request.method [ fhir:value "POST" ]; fhir:Bundle.entry.request.url [ fhir:value "Organization" ] ] ], [ fhir:index 3; fhir:Bundle.entry.fullUrl [ fhir:value "urn:uuid:00ef18ad-ed04-4b2c-81ee-b69bb243f0d5" ]; fhir:Bundle.entry.resource <urn:uuid:00ef18ad-ed04-4b2c-81ee-b69bb243f0d5>; fhir:Bundle.entry.request [ fhir:Bundle.entry.request.method [ fhir:value "POST" ]; fhir:Bundle.entry.request.url [ fhir:value "Organization" ] ] ], [ fhir:index 4; fhir:Bundle.entry.fullUrl [ fhir:value "urn:uuid:99309303-045e-4cf4-90d7-250d7a7476ea" ]; fhir:Bundle.entry.resource <urn:uuid:99309303-045e-4cf4-90d7-250d7a7476ea>; fhir:Bundle.entry.request [ fhir:Bundle.entry.request.method [ fhir:value "POST" ]; fhir:Bundle.entry.request.url [ fhir:value "ServiceRequest" ] ] ], [ fhir:index 5; fhir:Bundle.entry.fullUrl [ fhir:value "urn:uuid:8200dab6-18a2-4550-b913-a7db480c0804" ]; fhir:Bundle.entry.resource <urn:uuid:8200dab6-18a2-4550-b913-a7db480c0804>; fhir:Bundle.entry.request [ fhir:Bundle.entry.request.method [ fhir:value "POST" ]; fhir:Bundle.entry.request.url [ fhir:value "MolecularSequence" ] ] ], [ fhir:index 6; fhir:Bundle.entry.fullUrl [ fhir:value "urn:uuid:7c393185-f15c-45bc-a714-c0fdbea32675" ]; fhir:Bundle.entry.resource <urn:uuid:7c393185-f15c-45bc-a714-c0fdbea32675>; fhir:Bundle.entry.request [ fhir:Bundle.entry.request.method [ fhir:value "POST" ]; fhir:Bundle.entry.request.url [ fhir:value "MolecularSequence" ] ] ], [ fhir:index 7; fhir:Bundle.entry.fullUrl [ fhir:value "urn:uuid:65c85f14-c3a0-4b72-818f-820e04fcc621" ]; fhir:Bundle.entry.resource <urn:uuid:65c85f14-c3a0-4b72-818f-820e04fcc621>; fhir:Bundle.entry.request [ fhir:Bundle.entry.request.method [ fhir:value "POST" ]; fhir:Bundle.entry.request.url [ fhir:value "MolecularSequence" ] ] ], [ fhir:index 8; fhir:Bundle.entry.fullUrl [ fhir:value "urn:uuid:fbba9fe7-0ece-4ec1-9233-a437a8d242a0" ]; fhir:Bundle.entry.resource <urn:uuid:fbba9fe7-0ece-4ec1-9233-a437a8d242a0>; fhir:Bundle.entry.request [ fhir:Bundle.entry.request.method [ fhir:value "POST" ]; fhir:Bundle.entry.request.url [ fhir:value "MolecularSequence" ] ] ], [ fhir:index 9; fhir:Bundle.entry.fullUrl [ fhir:value "urn:uuid:b7765bbf-df40-486a-9f2f-404309643de6" ]; fhir:Bundle.entry.resource <urn:uuid:b7765bbf-df40-486a-9f2f-404309643de6>; fhir:Bundle.entry.request [ fhir:Bundle.entry.request.method [ fhir:value "POST" ]; fhir:Bundle.entry.request.url [ fhir:value "Observation" ] ] ], [ fhir:index 10; fhir:Bundle.entry.fullUrl [ fhir:value "urn:uuid:d98d92a7-0e86-4ae5-b036-b7e1bba6ec32" ]; fhir:Bundle.entry.resource <urn:uuid:d98d92a7-0e86-4ae5-b036-b7e1bba6ec32>; fhir:Bundle.entry.request [ fhir:Bundle.entry.request.method [ fhir:value "POST" ]; fhir:Bundle.entry.request.url [ fhir:value "Observation" ] ] ], [ fhir:index 11; fhir:Bundle.entry.fullUrl [ fhir:value "urn:uuid:49a86246-4004-42eb-9bdc-f542f93f9228" ]; fhir:Bundle.entry.resource <urn:uuid:49a86246-4004-42eb-9bdc-f542f93f9228>; fhir:Bundle.entry.request [ fhir:Bundle.entry.request.method [ fhir:value "POST" ]; fhir:Bundle.entry.request.url [ fhir:value "Observation" ] ] ], [ fhir:index 12; fhir:Bundle.entry.fullUrl [ fhir:value "urn:uuid:cbabf93e-1b4b-46f2-ba1e-d84862670670" ]; fhir:Bundle.entry.resource <urn:uuid:cbabf93e-1b4b-46f2-ba1e-d84862670670>; fhir:Bundle.entry.request [ fhir:Bundle.entry.request.method [ fhir:value "POST" ]; fhir:Bundle.entry.request.url [ fhir:value "MolecularSequence" ] ] ], [ fhir:index 13; fhir:Bundle.entry.fullUrl [ fhir:value "urn:uuid:c233ad3d-1572-48d6-93da-0a583535e138" ]; fhir:Bundle.entry.resource <urn:uuid:c233ad3d-1572-48d6-93da-0a583535e138>; fhir:Bundle.entry.request [ fhir:Bundle.entry.request.method [ fhir:value "POST" ]; fhir:Bundle.entry.request.url [ fhir:value "MolecularSequence" ] ] ], [ fhir:index 14; fhir:Bundle.entry.fullUrl [ fhir:value "urn:uuid:05fa52d7-5c67-460a-8722-d3460b24d6fe" ]; fhir:Bundle.entry.resource <urn:uuid:05fa52d7-5c67-460a-8722-d3460b24d6fe>; fhir:Bundle.entry.request [ fhir:Bundle.entry.request.method [ fhir:value "POST" ]; fhir:Bundle.entry.request.url [ fhir:value "MolecularSequence" ] ] ], [ fhir:index 15; fhir:Bundle.entry.fullUrl [ fhir:value "urn:uuid:db69e549-6267-4777-b4b9-8813f3329309" ]; fhir:Bundle.entry.resource <urn:uuid:db69e549-6267-4777-b4b9-8813f3329309>; fhir:Bundle.entry.request [ fhir:Bundle.entry.request.method [ fhir:value "POST" ]; fhir:Bundle.entry.request.url [ fhir:value "MolecularSequence" ] ] ], [ fhir:index 16; fhir:Bundle.entry.fullUrl [ fhir:value "urn:uuid:e2092243-2970-49d2-a90f-b90d1d49715a" ]; fhir:Bundle.entry.resource <urn:uuid:e2092243-2970-49d2-a90f-b90d1d49715a>; fhir:Bundle.entry.request [ fhir:Bundle.entry.request.method [ fhir:value "POST" ]; fhir:Bundle.entry.request.url [ fhir:value "Observation" ] ] ], [ fhir:index 17; fhir:Bundle.entry.fullUrl [ fhir:value "urn:uuid:792be53e-d4fb-4887-a367-815ef6c706e5" ]; fhir:Bundle.entry.resource <urn:uuid:792be53e-d4fb-4887-a367-815ef6c706e5>; fhir:Bundle.entry.request [ fhir:Bundle.entry.request.method [ fhir:value "POST" ]; fhir:Bundle.entry.request.url [ fhir:value "Observation" ] ] ], [ fhir:index 18; fhir:Bundle.entry.fullUrl [ fhir:value "urn:uuid:60613a43-c4cb-4502-b3e2-cf9215feaa70" ]; fhir:Bundle.entry.resource <urn:uuid:60613a43-c4cb-4502-b3e2-cf9215feaa70>; fhir:Bundle.entry.request [ fhir:Bundle.entry.request.method [ fhir:value "POST" ]; fhir:Bundle.entry.request.url [ fhir:value "Observation" ] ] ], [ fhir:index 19; fhir:Bundle.entry.fullUrl [ fhir:value "urn:uuid:bb55c2bc-5ad2-4bc1-8ff3-c407d06b12d0" ]; fhir:Bundle.entry.resource <urn:uuid:bb55c2bc-5ad2-4bc1-8ff3-c407d06b12d0>; fhir:Bundle.entry.request [ fhir:Bundle.entry.request.method [ fhir:value "POST" ]; fhir:Bundle.entry.request.url [ fhir:value "MolecularSequence" ] ] ], [ fhir:index 20; fhir:Bundle.entry.fullUrl [ fhir:value "urn:uuid:46938bb2-0486-4e87-bfd3-89aab2d5e22f" ]; fhir:Bundle.entry.resource <urn:uuid:46938bb2-0486-4e87-bfd3-89aab2d5e22f>; fhir:Bundle.entry.request [ fhir:Bundle.entry.request.method [ fhir:value "POST" ]; fhir:Bundle.entry.request.url [ fhir:value "MolecularSequence" ] ] ], [ fhir:index 21; fhir:Bundle.entry.fullUrl [ fhir:value "urn:uuid:2ae2ff34-279e-43c2-9018-b054fd3fc1ce" ]; fhir:Bundle.entry.resource <urn:uuid:2ae2ff34-279e-43c2-9018-b054fd3fc1ce>; fhir:Bundle.entry.request [ fhir:Bundle.entry.request.method [ fhir:value "POST" ]; fhir:Bundle.entry.request.url [ fhir:value "MolecularSequence" ] ] ], [ fhir:index 22; fhir:Bundle.entry.fullUrl [ fhir:value "urn:uuid:19153ef1-68c6-47a2-9676-c4eefbd39af9" ]; fhir:Bundle.entry.resource <urn:uuid:19153ef1-68c6-47a2-9676-c4eefbd39af9>; fhir:Bundle.entry.request [ fhir:Bundle.entry.request.method [ fhir:value "POST" ]; fhir:Bundle.entry.request.url [ fhir:value "MolecularSequence" ] ] ], [ fhir:index 23; fhir:Bundle.entry.fullUrl [ fhir:value "urn:uuid:709c5315-9403-4867-9d82-0b953836665f" ]; fhir:Bundle.entry.resource <urn:uuid:709c5315-9403-4867-9d82-0b953836665f>; fhir:Bundle.entry.request [ fhir:Bundle.entry.request.method [ fhir:value "POST" ]; fhir:Bundle.entry.request.url [ fhir:value "Observation" ] ] ], [ fhir:index 24; fhir:Bundle.entry.fullUrl [ fhir:value "urn:uuid:8b2aa21c-1426-4717-8ab0-a84d83df7d47" ]; fhir:Bundle.entry.resource <urn:uuid:8b2aa21c-1426-4717-8ab0-a84d83df7d47>; fhir:Bundle.entry.request [ fhir:Bundle.entry.request.method [ fhir:value "POST" ]; fhir:Bundle.entry.request.url [ fhir:value "Observation" ] ] ], [ fhir:index 25; fhir:Bundle.entry.fullUrl [ fhir:value "urn:uuid:0e0a780e-4486-4cd0-bfae-7243c579f208" ]; fhir:Bundle.entry.resource <urn:uuid:0e0a780e-4486-4cd0-bfae-7243c579f208>; fhir:Bundle.entry.request [ fhir:Bundle.entry.request.method [ fhir:value "POST" ]; fhir:Bundle.entry.request.url [ fhir:value "Observation" ] ] ], [ fhir:index 26; fhir:Bundle.entry.fullUrl [ fhir:value "urn:uuid:b0a4b18e-94e7-4b1b-8031-c7ae4bdd8db9" ]; fhir:Bundle.entry.resource <urn:uuid:b0a4b18e-94e7-4b1b-8031-c7ae4bdd8db9>; fhir:Bundle.entry.request [ fhir:Bundle.entry.request.method [ fhir:value "POST" ]; fhir:Bundle.entry.request.url [ fhir:value "DiagnosticReport" ] ] ]. <urn:uuid:13f34265-335c-4853-bc38-0815315edafa> a fhir:Patient; fhir:DomainResource.text [ fhir:Narrative.status [ fhir:value "generated" ]; fhir:Narrative.div "<div xmlns=\"http://www.w3.org/1999/xhtml\">\n <h4>Donor </h4>\n <p>name: John Storm</p>\n <p>gender: male</p>\n <p>born: 1986-12-31</p>\n </div>" ]; fhir:Patient.identifier [ fhir:index 0; fhir:Identifier.use [ fhir:value "usual" ]; fhir:Identifier.type [ fhir:CodeableConcept.coding [ fhir:index 0; fhir:Coding.system [ fhir:value "http://terminology.hl7.org/CodeSystem/v2-0203" ]; fhir:Coding.code [ fhir:value "DR" ] ] ]; fhir:Identifier.system [ fhir:value "urn:oid:0.0.0.0.0.0.0" ]; fhir:Identifier.value [ fhir:value "12345" ]; fhir:Identifier.period [ fhir:Period.start [ fhir:value "2012-11-10"^^xsd:date ] ]; fhir:Identifier.assigner [ fhir:Reference.display [ fhir:value "aDonorRegistry" ] ] ]; fhir:Patient.name [ fhir:index 0; fhir:HumanName.use [ fhir:value "official" ]; fhir:HumanName.text [ fhir:value "John Storm" ]; fhir:HumanName.family [ fhir:value "Storm" ]; fhir:HumanName.given [ fhir:value "John"; fhir:index 0 ] ], [ fhir:index 1; fhir:HumanName.use [ fhir:value "nickname" ]; fhir:HumanName.text [ fhir:value "Johnny Storm" ]; fhir:HumanName.family [ fhir:value "Storm" ]; fhir:HumanName.given [ fhir:value "Johnny"; fhir:index 0 ] ], [ fhir:index 2; fhir:HumanName.use [ fhir:value "nickname" ]; fhir:HumanName.text [ fhir:value "The Human Torch" ] ]; fhir:Patient.gender [ fhir:value "male"]; fhir:Patient.birthDate [ fhir:value "1986-12-31"^^xsd:date]. <urn:uuid:e44fbe33-6084-4ae2-a95e-8bc451c63340> a fhir:Specimen; fhir:Resource.meta [ fhir:Meta.profile [ fhir:value "http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/specimen"; fhir:index 0; fhir:link <http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/specimen> ] ]; fhir:DomainResource.text [ fhir:Narrative.status [ fhir:value "generated" ]; fhir:Narrative.div "<div xmlns=\"http://www.w3.org/1999/xhtml\">\n <pre>a buccal swab</pre>\n </div>" ]; fhir:Specimen.identifier [ fhir:index 0; fhir:Identifier.system [ fhir:value "http://myorgsurl.com" ]; fhir:Identifier.value [ fhir:value "123" ] ]; fhir:Specimen.accessionIdentifier [ fhir:Identifier.system [ fhir:value "http://mylabsurl.com" ]; fhir:Identifier.value [ fhir:value "456" ] ]; fhir:Specimen.type [ fhir:CodeableConcept.coding [ fhir:index 0; a sct:733104004; fhir:Coding.system [ fhir:value "http://snomed.info/sct" ]; fhir:Coding.code [ fhir:value "733104004" ]; fhir:Coding.display [ fhir:value "Swab from buccal mucosa (specimen)" ] ] ]; fhir:Specimen.subject [ fhir:Reference.reference [ fhir:value "urn:uuid:13f34265-335c-4853-bc38-0815315edafa" ]; fhir:Reference.type [ fhir:value "Patient" ]; fhir:Reference.display [ fhir:value "John Storm" ] ]. <urn:uuid:9243cc20-27bd-4f87-ba90-0328ed474950> a fhir:Organization; fhir:DomainResource.text [ fhir:Narrative.status [ fhir:value "generated" ]; fhir:Narrative.div "<div xmlns=\"http://www.w3.org/1999/xhtml\">\n <pre>aTypingLab, Inc</pre>\n </div>" ]; fhir:Organization.name [ fhir:value "aTypingLab Inc"]; fhir:Organization.alias [ fhir:value "aTL"; fhir:index 0 ]; fhir:Organization.telecom [ fhir:index 0; fhir:ContactPoint.system [ fhir:value "phone" ]; fhir:ContactPoint.value [ fhir:value "1-800-555-1234" ]; fhir:ContactPoint.use [ fhir:value "work" ]; fhir:ContactPoint.rank [ fhir:value "1"^^xsd:positiveInteger ] ]; fhir:Organization.address [ fhir:index 0; fhir:Address.use [ fhir:value "work" ]; fhir:Address.type [ fhir:value "both" ]; fhir:Address.text [ fhir:value "123 Main St, Sometown, ND 99999" ]; fhir:Address.line [ fhir:value "123 Main St"; fhir:index 0 ]; fhir:Address.city [ fhir:value "Sometown" ]; fhir:Address.state [ fhir:value "ND" ]; fhir:Address.postalCode [ fhir:value "99999" ]; fhir:Address.country [ fhir:value "USA" ] ]. <urn:uuid:00ef18ad-ed04-4b2c-81ee-b69bb243f0d5> a fhir:Organization; fhir:DomainResource.text [ fhir:Narrative.status [ fhir:value "generated" ]; fhir:Narrative.div "<div xmlns=\"http://www.w3.org/1999/xhtml\">\n <pre>aDonorRegistry</pre>\n </div>" ]; fhir:Organization.name [ fhir:value "aDonorRegistry"]; fhir:Organization.alias [ fhir:value "ADR"; fhir:index 0 ]; fhir:Organization.telecom [ fhir:index 0; fhir:ContactPoint.system [ fhir:value "phone" ]; fhir:ContactPoint.value [ fhir:value "1-800-555-6789" ]; fhir:ContactPoint.use [ fhir:value "work" ]; fhir:ContactPoint.rank [ fhir:value "1"^^xsd:positiveInteger ] ]; fhir:Organization.address [ fhir:index 0; fhir:Address.use [ fhir:value "work" ]; fhir:Address.type [ fhir:value "both" ]; fhir:Address.text [ fhir:value "456 Main St, Anytown ND, 00000" ]; fhir:Address.line [ fhir:value "456 Main St"; fhir:index 0 ]; fhir:Address.city [ fhir:value "Anytown" ]; fhir:Address.state [ fhir:value "ND" ]; fhir:Address.postalCode [ fhir:value "00000" ]; fhir:Address.country [ fhir:value "USA" ] ]. <urn:uuid:99309303-045e-4cf4-90d7-250d7a7476ea> a fhir:ServiceRequest; fhir:Resource.meta [ fhir:Meta.profile [ fhir:value "http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/servicerequest"; fhir:index 0; fhir:link <http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/servicerequest> ] ]; fhir:DomainResource.text [ fhir:Narrative.status [ fhir:value "generated" ]; fhir:Narrative.div "<div xmlns=\"http://www.w3.org/1999/xhtml\">\n <pre>HLA typing request for John Storm</pre>\n </div>" ]; fhir:ServiceRequest.status [ fhir:value "completed"]; fhir:ServiceRequest.intent [ fhir:value "order"]; fhir:ServiceRequest.code [ fhir:CodeableConcept.coding [ fhir:index 0; a loinc:13303-3; fhir:Coding.system [ fhir:value "http://loinc.org" ]; fhir:Coding.code [ fhir:value "13303-3" ]; fhir:Coding.display [ fhir:value "HLA-A+B+C (class I) [Type]" ] ] ]; fhir:ServiceRequest.subject [ fhir:Reference.reference [ fhir:value "urn:uuid:13f34265-335c-4853-bc38-0815315edafa" ]; fhir:Reference.type [ fhir:value "Patient" ]; fhir:Reference.display [ fhir:value "John Storm" ] ]; fhir:ServiceRequest.authoredOn [ fhir:value "2016-11-15"^^xsd:date]; fhir:ServiceRequest.requester [ fhir:Reference.reference [ fhir:value "urn:uuid:00ef18ad-ed04-4b2c-81ee-b69bb243f0d5" ]; fhir:Reference.type [ fhir:value "Organization" ]; fhir:Reference.display [ fhir:value "aDonorRegistry" ] ]; fhir:ServiceRequest.performer [ fhir:index 0; fhir:Reference.reference [ fhir:value "urn:uuid:9243cc20-27bd-4f87-ba90-0328ed474950" ]; fhir:Reference.type [ fhir:value "Organization" ]; fhir:Reference.display [ fhir:value "aTypingLab, Inc" ] ]; fhir:ServiceRequest.reasonCode [ fhir:index 0; fhir:CodeableConcept.text [ fhir:value "tissue typing for donor registry" ] ]. <urn:uuid:8200dab6-18a2-4550-b913-a7db480c0804> a fhir:MolecularSequence; fhir:DomainResource.text [ fhir:Narrative.status [ fhir:value "generated" ]; fhir:Narrative.div "<div xmlns=\"http://www.w3.org/1999/xhtml\">\n <pre>"HLA-A*01:01:01:01, exon 2"</pre>\n </div>" ]; fhir:MolecularSequence.type [ fhir:value "dna"]; fhir:MolecularSequence.coordinateSystem [ fhir:value "0"^^xsd:integer]; fhir:MolecularSequence.referenceSeq [ fhir:MolecularSequence.referenceSeq.referenceSeqId [ fhir:CodeableConcept.coding [ fhir:index 0; fhir:Coding.system [ fhir:value "http://www.ebi.ac.uk/ipd/imgt/hla" ]; fhir:Coding.version [ fhir:value "3.23" ]; fhir:Coding.code [ fhir:value "HLA00001" ] ]; fhir:CodeableConcept.text [ fhir:value "HLA-A*01:01:01:01" ] ]; fhir:MolecularSequence.referenceSeq.windowStart [ fhir:value "503"^^xsd:integer ]; fhir:MolecularSequence.referenceSeq.windowEnd [ fhir:value "773"^^xsd:integer ] ]; fhir:MolecularSequence.observedSeq [ fhir:value "GCTCCCACTCCATGAGGTATTTCTTCACATCCGTGTCCCGGCCCGGCCGCGGGGAGCCCCGCTTCATCGCCGTGGGCTACGTGGACGACACGCAGTTCGTGCGGTTCGACAGCGACGCCGCGAGCCAGAAGATGGAGCCGCGGGCGCCGTGGATAGAGCAGGAGGGGCCGGAGTATTGGGACCAGGAGACACGGAATATGAAGGCCCACTCACAGACTGACCGAGCGAACCTGGGGACCCTGCGCGGCTACTACAACCAGAGCGAGGACG"]. <urn:uuid:7c393185-f15c-45bc-a714-c0fdbea32675> a fhir:MolecularSequence; fhir:DomainResource.text [ fhir:Narrative.status [ fhir:value "generated" ]; fhir:Narrative.div "<div xmlns=\"http://www.w3.org/1999/xhtml\">\n <pre>"HLA-A*01:01:01:01, exon 3"</pre>\n </div>" ]; fhir:MolecularSequence.type [ fhir:value "dna"]; fhir:MolecularSequence.coordinateSystem [ fhir:value "0"^^xsd:integer]; fhir:MolecularSequence.referenceSeq [ fhir:MolecularSequence.referenceSeq.referenceSeqId [ fhir:CodeableConcept.coding [ fhir:index 0; fhir:Coding.system [ fhir:value "http://www.ebi.ac.uk/ipd/imgt/hla" ]; fhir:Coding.version [ fhir:value "3.23" ]; fhir:Coding.code [ fhir:value "HLA00001" ] ]; fhir:CodeableConcept.text [ fhir:value "HLA-A*01:01:01:01" ] ]; fhir:MolecularSequence.referenceSeq.windowStart [ fhir:value "1014"^^xsd:integer ]; fhir:MolecularSequence.referenceSeq.windowEnd [ fhir:value "1290"^^xsd:integer ] ]; fhir:MolecularSequence.observedSeq [ fhir:value "GTTCTCACACCATCCAGATAATGTATGGCTGCGACGTGGGGCCGGACGGGCGCTTCCTCCGCGGGTACCGGCAGGACGCCTACGACGGCAAGGATTACATCGCCCTGAACGAGGACCTGCGCTCTTGGACCGCGGCGGACATGGCAGCTCAGATCACCAAGCGCAAGTGGGAGGCGGTCCATGCGGCGGAGCAGCGGAGAGTCTACCTGGAGGGCCGGTGCGTGGACGGGCTCCGCAGATACCTGGAGAACGGGAAGGAGACGCTGCAGCGCACGG"]. <urn:uuid:65c85f14-c3a0-4b72-818f-820e04fcc621> a fhir:MolecularSequence; fhir:DomainResource.text [ fhir:Narrative.status [ fhir:value "generated" ]; fhir:Narrative.div "<div xmlns=\"http://www.w3.org/1999/xhtml\">\n <pre>"HLA-A*01:02, exon 2"</pre>\n </div>" ]; fhir:MolecularSequence.type [ fhir:value "dna"]; fhir:MolecularSequence.coordinateSystem [ fhir:value "0"^^xsd:integer]; fhir:MolecularSequence.referenceSeq [ fhir:MolecularSequence.referenceSeq.referenceSeqId [ fhir:CodeableConcept.coding [ fhir:index 0; fhir:Coding.system [ fhir:value "http://www.ebi.ac.uk/ipd/imgt/hla" ]; fhir:Coding.version [ fhir:value "3.23" ]; fhir:Coding.code [ fhir:value "HLA00002" ] ]; fhir:CodeableConcept.text [ fhir:value "HLA-A*01:02" ] ]; fhir:MolecularSequence.referenceSeq.windowStart [ fhir:value "503"^^xsd:integer ]; fhir:MolecularSequence.referenceSeq.windowEnd [ fhir:value "773"^^xsd:integer ] ]; fhir:MolecularSequence.observedSeq [ fhir:value "GCTCCCACTCCATGAGGTATTTCTCCACATCCGTGTCCCGGCCCGGCAGTGGAGAGCCCCGCTTCATCGCAGTGGGCTACGTGGACGACACGCAGTTCGTGCGGTTCGACAGCGACGCCGCGAGCCAGAAGATGGAGCCGCGGGCGCCGTGGATAGAGCAGGAGGGGCCGGAGTATTGGGACCAGGAGACACGGAATATGAAGGCCCACTCACAGACTGACCGAGCGAACCTGGGGACCCTGCGCGGCTACTACAACCAGAGCGAGGACG"]. <urn:uuid:fbba9fe7-0ece-4ec1-9233-a437a8d242a0> a fhir:MolecularSequence; fhir:DomainResource.text [ fhir:Narrative.status [ fhir:value "generated" ]; fhir:Narrative.div "<div xmlns=\"http://www.w3.org/1999/xhtml\">\n <pre>"HLA-A*01:02, exon 3"</pre>\n </div>" ]; fhir:MolecularSequence.type [ fhir:value "dna"]; fhir:MolecularSequence.coordinateSystem [ fhir:value "0"^^xsd:integer]; fhir:MolecularSequence.referenceSeq [ fhir:MolecularSequence.referenceSeq.referenceSeqId [ fhir:CodeableConcept.coding [ fhir:index 0; fhir:Coding.system [ fhir:value "http://www.ebi.ac.uk/ipd/imgt/hla" ]; fhir:Coding.version [ fhir:value "3.23" ]; fhir:Coding.code [ fhir:value "HLA00002" ] ]; fhir:CodeableConcept.text [ fhir:value "HLA-A*01:02" ] ]; fhir:MolecularSequence.referenceSeq.windowStart [ fhir:value "1014"^^xsd:integer ]; fhir:MolecularSequence.referenceSeq.windowEnd [ fhir:value "1290"^^xsd:integer ] ]; fhir:MolecularSequence.observedSeq [ fhir:value "GTTCTCACACCATCCAGATAATGTATGGCTGCGACGTGGGGCCGGACGGGCGCTTCCTCCGCGGGTACCGGCAGGACGCCTACGACGGCAAGGATTACATCGCCCTGAACGAGGACCTGCGCTCTTGGACCGCGGCGGACATGGCAGCTCAGATCACCAAGCGCAAGTGGGAGGCGGTCCATGCGGCGGAGCAGCGGAGAGTCTACCTGGAGGGCCGGTGCGTGGACGGGCTCCGCAGATACCTGGAGAACGGGAAGGAGACGCTGCAGCGCACGG"]. <urn:uuid:b7765bbf-df40-486a-9f2f-404309643de6> a fhir:Observation; fhir:Resource.meta [ fhir:Meta.profile [ fhir:value "http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/obs-haplotype"; fhir:index 0; fhir:link <http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/obs-haplotype> ] ]; fhir:DomainResource.text [ fhir:Narrative.status [ fhir:value "generated" ]; fhir:Narrative.div "<div xmlns=\"http://www.w3.org/1999/xhtml\">\n <pre>HLA-A:01:01:01G</pre>\n </div>" ]; fhir:Observation.status [ fhir:value "final"]; fhir:Observation.category [ fhir:index 0; fhir:CodeableConcept.coding [ fhir:index 0; fhir:Coding.system [ fhir:value "http://terminology.hl7.org/CodeSystem/observation-category" ]; fhir:Coding.code [ fhir:value "laboratory" ] ] ]; fhir:Observation.code [ fhir:CodeableConcept.coding [ fhir:index 0; a loinc:84414-2; fhir:Coding.system [ fhir:value "http://loinc.org" ]; fhir:Coding.code [ fhir:value "84414-2" ]; fhir:Coding.display [ fhir:value "Haplotype name" ] ] ]; fhir:Observation.subject [ fhir:Reference.reference [ fhir:value "urn:uuid:13f34265-335c-4853-bc38-0815315edafa" ]; fhir:Reference.type [ fhir:value "Patient" ]; fhir:Reference.display [ fhir:value "John Storm" ] ]; fhir:Observation.effectiveDateTime [ fhir:value "2016-12-15"^^xsd:date]; fhir:Observation.valueCodeableConcept [ fhir:CodeableConcept.coding [ fhir:index 0; fhir:Coding.system [ fhir:value "http://www.ebi.ac.uk/ipd/imgt/hla" ]; fhir:Coding.version [ fhir:value "3.23" ]; fhir:Coding.code [ fhir:value "HLA-A*01:01:01G" ]; fhir:Coding.display [ fhir:value "HLA-A*01:01:01G" ] ] ]; fhir:Observation.method [ fhir:CodeableConcept.coding [ fhir:index 0; fhir:Coding.system [ fhir:value "http://www.ncbi.nlm.nih.gov/gtr/" ]; fhir:Coding.code [ fhir:value "GTR000000000.0" ] ]; fhir:CodeableConcept.text [ fhir:value "NGS based Class I HLA-A, -B, -C genotyping" ] ]; fhir:Observation.specimen [ fhir:Reference.reference [ fhir:value "urn:uuid:e44fbe33-6084-4ae2-a95e-8bc451c63340" ]; fhir:Reference.display [ fhir:value "buccal swab from John Storm" ] ]; fhir:Observation.derivedFrom [ fhir:index 0; fhir:Reference.reference [ fhir:value "urn:uuid:8200dab6-18a2-4550-b913-a7db480c0804" ]; fhir:Reference.type [ fhir:value "MolecularSequence" ]; fhir:Reference.display [ fhir:value "HLA-A*01:01:01:01, exon 2" ] ], [ fhir:index 1; fhir:Reference.reference [ fhir:value "urn:uuid:7c393185-f15c-45bc-a714-c0fdbea32675" ]; fhir:Reference.type [ fhir:value "MolecularSequence" ]; fhir:Reference.display [ fhir:value "HLA-A*01:01:01:01, exon 3" ] ]; fhir:Observation.component [ fhir:index 0; fhir:Observation.component.code [ fhir:CodeableConcept.coding [ fhir:index 0; a loinc:48018-6; fhir:Coding.system [ fhir:value "http://loinc.org" ]; fhir:Coding.code [ fhir:value "48018-6" ]; fhir:Coding.display [ fhir:value "Gene studied [ID]" ] ] ]; fhir:Observation.component.valueCodeableConcept [ fhir:CodeableConcept.coding [ fhir:index 0; fhir:Coding.system [ fhir:value "https://www.genenames.org/" ]; fhir:Coding.code [ fhir:value "HGNC:4931" ]; fhir:Coding.display [ fhir:value "HLA-A" ] ] ] ], [ fhir:index 1; fhir:Observation.component.code [ fhir:CodeableConcept.coding [ fhir:index 0; a loinc:81293-3; fhir:Coding.system [ fhir:value "http://loinc.org" ]; fhir:Coding.code [ fhir:value "81293-3" ]; fhir:Coding.display [ fhir:value "Description of ranges of DNA sequences examined" ] ] ]; fhir:Observation.component.valueCodeableConcept [ fhir:CodeableConcept.text [ fhir:value "Exons 2 and 3" ] ] ]. <urn:uuid:d98d92a7-0e86-4ae5-b036-b7e1bba6ec32> a fhir:Observation; fhir:Resource.meta [ fhir:Meta.profile [ fhir:value "http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/obs-haplotype"; fhir:index 0; fhir:link <http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/obs-haplotype> ] ]; fhir:DomainResource.text [ fhir:Narrative.status [ fhir:value "generated" ]; fhir:Narrative.div "<div xmlns=\"http://www.w3.org/1999/xhtml\">\n <pre>HLA-A*01:02</pre>\n </div>" ]; fhir:Observation.status [ fhir:value "final"]; fhir:Observation.category [ fhir:index 0; fhir:CodeableConcept.coding [ fhir:index 0; fhir:Coding.system [ fhir:value "http://terminology.hl7.org/CodeSystem/observation-category" ]; fhir:Coding.code [ fhir:value "laboratory" ] ] ]; fhir:Observation.code [ fhir:CodeableConcept.coding [ fhir:index 0; a loinc:84414-2; fhir:Coding.system [ fhir:value "http://loinc.org" ]; fhir:Coding.code [ fhir:value "84414-2" ]; fhir:Coding.display [ fhir:value "Haplotype name" ] ] ]; fhir:Observation.subject [ fhir:Reference.reference [ fhir:value "urn:uuid:13f34265-335c-4853-bc38-0815315edafa" ]; fhir:Reference.type [ fhir:value "Patient" ]; fhir:Reference.display [ fhir:value "John Storm" ] ]; fhir:Observation.effectiveDateTime [ fhir:value "2016-12-15"^^xsd:date]; fhir:Observation.valueCodeableConcept [ fhir:CodeableConcept.coding [ fhir:index 0; fhir:Coding.system [ fhir:value "http://www.ebi.ac.uk/ipd/imgt/hla" ]; fhir:Coding.version [ fhir:value "3.23" ]; fhir:Coding.code [ fhir:value "HLA-A*01:02" ]; fhir:Coding.display [ fhir:value "HLA-A*01:02" ] ] ]; fhir:Observation.method [ fhir:CodeableConcept.coding [ fhir:index 0; fhir:Coding.system [ fhir:value "http://www.ncbi.nlm.nih.gov/gtr/" ]; fhir:Coding.code [ fhir:value "GTR000000000.0" ] ]; fhir:CodeableConcept.text [ fhir:value "NGS based Class I HLA-A, -B, -C genotyping" ] ]; fhir:Observation.specimen [ fhir:Reference.reference [ fhir:value "urn:uuid:e44fbe33-6084-4ae2-a95e-8bc451c63340" ]; fhir:Reference.display [ fhir:value "buccal swab from John Storm" ] ]; fhir:Observation.derivedFrom [ fhir:index 0; fhir:Reference.reference [ fhir:value "urn:uuid:65c85f14-c3a0-4b72-818f-820e04fcc621" ]; fhir:Reference.type [ fhir:value "MolecularSequence" ]; fhir:Reference.display [ fhir:value "HLA-A*01:02, exon 2" ] ], [ fhir:index 1; fhir:Reference.reference [ fhir:value "urn:uuid:fbba9fe7-0ece-4ec1-9233-a437a8d242a0" ]; fhir:Reference.type [ fhir:value "MolecularSequence" ]; fhir:Reference.display [ fhir:value "HLA-A*01:02, exon 3" ] ]; fhir:Observation.component [ fhir:index 0; fhir:Observation.component.code [ fhir:CodeableConcept.coding [ fhir:index 0; a loinc:48018-6; fhir:Coding.system [ fhir:value "http://loinc.org" ]; fhir:Coding.code [ fhir:value "48018-6" ]; fhir:Coding.display [ fhir:value "Gene studied [ID]" ] ] ]; fhir:Observation.component.valueCodeableConcept [ fhir:CodeableConcept.coding [ fhir:index 0; fhir:Coding.system [ fhir:value "https://www.genenames.org/" ]; fhir:Coding.code [ fhir:value "HGNC:4931" ]; fhir:Coding.display [ fhir:value "HLA-A" ] ] ] ], [ fhir:index 1; fhir:Observation.component.code [ fhir:CodeableConcept.coding [ fhir:index 0; a loinc:81293-3; fhir:Coding.system [ fhir:value "http://loinc.org" ]; fhir:Coding.code [ fhir:value "81293-3" ]; fhir:Coding.display [ fhir:value "Description of ranges of DNA sequences examined" ] ] ]; fhir:Observation.component.valueCodeableConcept [ fhir:CodeableConcept.text [ fhir:value "Exons 2 and 3" ] ] ]. <urn:uuid:49a86246-4004-42eb-9bdc-f542f93f9228> a fhir:Observation; fhir:Resource.meta [ fhir:Meta.profile [ fhir:value "http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/obs-genotype"; fhir:index 0; fhir:link <http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/obs-genotype> ] ]; fhir:DomainResource.text [ fhir:Narrative.status [ fhir:value "generated" ]; fhir:Narrative.div "<div xmlns=\"http://www.w3.org/1999/xhtml\">\n <pre>HLA-A:01:01G+HLA-A*01:02</pre>\n </div>" ]; fhir:Observation.basedOn [ fhir:index 0; fhir:Reference.reference [ fhir:value "urn:uuid:99309303-045e-4cf4-90d7-250d7a7476ea" ]; fhir:Reference.type [ fhir:value "ServiceRequest" ]; fhir:Reference.display [ fhir:value "Class I HLA genotyping for John Storm" ] ]; fhir:Observation.status [ fhir:value "final"]; fhir:Observation.category [ fhir:index 0; fhir:CodeableConcept.coding [ fhir:index 0; fhir:Coding.system [ fhir:value "http://terminology.hl7.org/CodeSystem/observation-category" ]; fhir:Coding.code [ fhir:value "laboratory" ] ] ]; fhir:Observation.code [ fhir:CodeableConcept.coding [ fhir:index 0; a loinc:84413-4; fhir:Coding.system [ fhir:value "http://loinc.org" ]; fhir:Coding.code [ fhir:value "84413-4" ]; fhir:Coding.display [ fhir:value "Genotype display name" ] ] ]; fhir:Observation.subject [ fhir:Reference.reference [ fhir:value "urn:uuid:13f34265-335c-4853-bc38-0815315edafa" ]; fhir:Reference.type [ fhir:value "Patient" ]; fhir:Reference.display [ fhir:value "John Storm" ] ]; fhir:Observation.effectiveDateTime [ fhir:value "2016-12-15"^^xsd:date]; fhir:Observation.valueCodeableConcept [ fhir:CodeableConcept.coding [ fhir:index 0; fhir:Coding.system [ fhir:value "https://glstring.org" ]; fhir:Coding.version [ fhir:value "1.0" ]; fhir:Coding.code [ fhir:value "hla#3.23.0#HLA-A:01:01G+HLA-A*01:02" ] ] ]; fhir:Observation.method [ fhir:CodeableConcept.coding [ fhir:index 0; fhir:Coding.system [ fhir:value "http://www.ncbi.nlm.nih.gov/gtr/" ]; fhir:Coding.code [ fhir:value "GTR000000000.0" ] ]; fhir:CodeableConcept.text [ fhir:value "NGS based Class I HLA-A, -B, -C genotyping" ] ]; fhir:Observation.specimen [ fhir:Reference.reference [ fhir:value "urn:uuid:e44fbe33-6084-4ae2-a95e-8bc451c63340" ]; fhir:Reference.display [ fhir:value "buccal swab from John Storm" ] ]; fhir:Observation.derivedFrom [ fhir:index 0; fhir:Reference.reference [ fhir:value "urn:uuid:b7765bbf-df40-486a-9f2f-404309643de6" ]; fhir:Reference.type [ fhir:value "Observation" ]; fhir:Reference.display [ fhir:value "HLA-A*01:01:01G, exons 2 and 3" ] ], [ fhir:index 1; fhir:Reference.reference [ fhir:value "urn:uuid:d98d92a7-0e86-4ae5-b036-b7e1bba6ec32" ]; fhir:Reference.type [ fhir:value "Observation" ]; fhir:Reference.display [ fhir:value "HLA-A*01:02, exons 2 and 3" ] ]; fhir:Observation.component [ fhir:index 0; fhir:Observation.component.code [ fhir:CodeableConcept.coding [ fhir:index 0; a loinc:48018-6; fhir:Coding.system [ fhir:value "http://loinc.org" ]; fhir:Coding.code [ fhir:value "48018-6" ]; fhir:Coding.display [ fhir:value "Gene studied [ID]" ] ] ]; fhir:Observation.component.valueCodeableConcept [ fhir:CodeableConcept.coding [ fhir:index 0; fhir:Coding.system [ fhir:value "https://www.genenames.org/" ]; fhir:Coding.code [ fhir:value "HGNC:4931" ]; fhir:Coding.display [ fhir:value "HLA-A" ] ] ] ]. <urn:uuid:cbabf93e-1b4b-46f2-ba1e-d84862670670> a fhir:MolecularSequence; fhir:DomainResource.text [ fhir:Narrative.status [ fhir:value "generated" ]; fhir:Narrative.div "<div xmlns=\"http://www.w3.org/1999/xhtml\">\n <pre>"HLA-B*15:01:01:01, exon 2"</pre>\n </div>" ]; fhir:MolecularSequence.type [ fhir:value "dna"]; fhir:MolecularSequence.coordinateSystem [ fhir:value "0"^^xsd:integer]; fhir:MolecularSequence.referenceSeq [ fhir:MolecularSequence.referenceSeq.referenceSeqId [ fhir:CodeableConcept.coding [ fhir:index 0; fhir:Coding.system [ fhir:value "http://www.ebi.ac.uk/ipd/imgt/hla" ]; fhir:Coding.version [ fhir:value "3.23" ]; fhir:Coding.code [ fhir:value "HLA00162" ] ]; fhir:CodeableConcept.text [ fhir:value "HLA-B*15:01:01:01" ] ]; fhir:MolecularSequence.referenceSeq.windowStart [ fhir:value "486"^^xsd:integer ]; fhir:MolecularSequence.referenceSeq.windowEnd [ fhir:value "756"^^xsd:integer ] ]; fhir:MolecularSequence.observedSeq [ fhir:value "GCTCCCACTCCATGAGGTATTTCTACACCGCCATGTCCCGGCCCGGCCGCGGGGAGCCCCGCTTCATCGCAGTGGGCTACGTGGACGACACCCAGTTCGTGAGGTTCGACAGCGACGCCGCGAGTCCGAGGATGGCGCCCCGGGCGCCATGGATAGAGCAGGAGGGGCCGGAGTATTGGGACCGGGAGACACAGATCTCCAAGACCAACACACAGACTTACCGAGAGAGCCTGCGGAACCTGCGCGGCTACTACAACCAGAGCGAGGCCG"]. <urn:uuid:c233ad3d-1572-48d6-93da-0a583535e138> a fhir:MolecularSequence; fhir:DomainResource.text [ fhir:Narrative.status [ fhir:value "generated" ]; fhir:Narrative.div "<div xmlns=\"http://www.w3.org/1999/xhtml\">\n <pre>"HLA-B*15:01:01:01, exon 3"</pre>\n </div>" ]; fhir:MolecularSequence.type [ fhir:value "dna"]; fhir:MolecularSequence.coordinateSystem [ fhir:value "0"^^xsd:integer]; fhir:MolecularSequence.referenceSeq [ fhir:MolecularSequence.referenceSeq.referenceSeqId [ fhir:CodeableConcept.coding [ fhir:index 0; fhir:Coding.system [ fhir:value "http://www.ebi.ac.uk/ipd/imgt/hla" ]; fhir:Coding.version [ fhir:value "3.23" ]; fhir:Coding.code [ fhir:value "HLA00162" ] ]; fhir:CodeableConcept.text [ fhir:value "HLA-B*15:01:01:01" ] ]; fhir:MolecularSequence.referenceSeq.windowStart [ fhir:value "1001"^^xsd:integer ]; fhir:MolecularSequence.referenceSeq.windowEnd [ fhir:value "1277"^^xsd:integer ] ]; fhir:MolecularSequence.observedSeq [ fhir:value "GGTCTCACACCCTCCAGAGGATGTACGGCTGCGACGTGGGGCCGGACGGGCGCCTCCTCCGCGGGCATGACCAGTCCGCCTACGACGGCAAGGATTACATCGCCCTGAACGAGGACCTGAGCTCCTGGACCGCGGCGGACACGGCGGCTCAGATCACCCAGCGCAAGTGGGAGGCGGCCCGTGAGGCGGAGCAGTGGAGAGCCTACCTGGAGGGCCTGTGCGTGGAGTGGCTCCGCAGATACCTGGAGAACGGGAAGGAGACGCTGCAGCGCGCGG"]. <urn:uuid:05fa52d7-5c67-460a-8722-d3460b24d6fe> a fhir:MolecularSequence; fhir:DomainResource.text [ fhir:Narrative.status [ fhir:value "generated" ]; fhir:Narrative.div "<div xmlns=\"http://www.w3.org/1999/xhtml\">\n <pre>"HLA-B*57:01:01, exon 2"</pre>\n </div>" ]; fhir:MolecularSequence.type [ fhir:value "dna"]; fhir:MolecularSequence.coordinateSystem [ fhir:value "0"^^xsd:integer]; fhir:MolecularSequence.referenceSeq [ fhir:MolecularSequence.referenceSeq.referenceSeqId [ fhir:CodeableConcept.coding [ fhir:index 0; fhir:Coding.system [ fhir:value "http://www.ebi.ac.uk/ipd/imgt/hla" ]; fhir:Coding.version [ fhir:value "3.23" ]; fhir:Coding.code [ fhir:value "HLA00381" ] ]; fhir:CodeableConcept.text [ fhir:value "HLA-B*57:01:01" ] ]; fhir:MolecularSequence.referenceSeq.windowStart [ fhir:value "485"^^xsd:integer ]; fhir:MolecularSequence.referenceSeq.windowEnd [ fhir:value "755"^^xsd:integer ] ]; fhir:MolecularSequence.observedSeq [ fhir:value "GCTCCCACTCCATGAGGTATTTCTACACCGCCATGTCCCGGCCCGGCCGCGGGGAGCCCCGCTTCATCGCAGTGGGCTACGTGGACGACACCCAGTTCGTGAGGTTCGACAGCGACGCCGCGAGTCCGAGGATGGCGCCCCGGGCGCCATGGATAGAGCAGGAGGGGCCGGAGTATTGGGACGGGGAGACACGGAACATGAAGGCCTCCGCGCAGACTTACCGAGAGAACCTGCGGATCGCGCTCCGCTACTACAACCAGAGCGAGGCCG"]. <urn:uuid:db69e549-6267-4777-b4b9-8813f3329309> a fhir:MolecularSequence; fhir:DomainResource.text [ fhir:Narrative.status [ fhir:value "generated" ]; fhir:Narrative.div "<div xmlns=\"http://www.w3.org/1999/xhtml\">\n <pre>"HLA-B*57:01:01, exon 3"</pre>\n </div>" ]; fhir:MolecularSequence.type [ fhir:value "dna"]; fhir:MolecularSequence.coordinateSystem [ fhir:value "0"^^xsd:integer]; fhir:MolecularSequence.referenceSeq [ fhir:MolecularSequence.referenceSeq.referenceSeqId [ fhir:CodeableConcept.coding [ fhir:index 0; fhir:Coding.system [ fhir:value "http://www.ebi.ac.uk/ipd/imgt/hla" ]; fhir:Coding.version [ fhir:value "3.23" ]; fhir:Coding.code [ fhir:value "HLA00381" ] ]; fhir:CodeableConcept.text [ fhir:value "HLA-B*57:01:01" ] ]; fhir:MolecularSequence.referenceSeq.windowStart [ fhir:value "1001"^^xsd:integer ]; fhir:MolecularSequence.referenceSeq.windowEnd [ fhir:value "1277"^^xsd:integer ] ]; fhir:MolecularSequence.observedSeq [ fhir:value "GGTCTCACATCATCCAGGTGATGTATGGCTGCGACGTGGGGCCGGACGGGCGCCTCCTCCGCGGGCATGACCAGTCCGCCTACGACGGCAAGGATTACATCGCCCTGAACGAGGACCTGAGCTCCTGGACCGCGGCGGACACGGCGGCTCAGATCACCCAGCGCAAGTGGGAGGCGGCCCGTGTGGCGGAGCAGCTGAGAGCCTACCTGGAGGGCCTGTGCGTGGAGTGGCTCCGCAGATACCTGGAGAACGGGAAGGAGACGCTGCAGCGCGCGG"]. <urn:uuid:e2092243-2970-49d2-a90f-b90d1d49715a> a fhir:Observation; fhir:Resource.meta [ fhir:Meta.profile [ fhir:value "http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/obs-haplotype"; fhir:index 0; fhir:link <http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/obs-haplotype> ] ]; fhir:DomainResource.text [ fhir:Narrative.status [ fhir:value "generated" ]; fhir:Narrative.div "<div xmlns=\"http://www.w3.org/1999/xhtml\">\n <pre>HLA-B*15:01:01G</pre>\n </div>" ]; fhir:Observation.status [ fhir:value "final"]; fhir:Observation.category [ fhir:index 0; fhir:CodeableConcept.coding [ fhir:index 0; fhir:Coding.system [ fhir:value "http://terminology.hl7.org/CodeSystem/observation-category" ]; fhir:Coding.code [ fhir:value "laboratory" ] ] ]; fhir:Observation.code [ fhir:CodeableConcept.coding [ fhir:index 0; a loinc:84414-2; fhir:Coding.system [ fhir:value "http://loinc.org" ]; fhir:Coding.code [ fhir:value "84414-2" ]; fhir:Coding.display [ fhir:value "Haplotype name" ] ] ]; fhir:Observation.subject [ fhir:Reference.reference [ fhir:value "urn:uuid:13f34265-335c-4853-bc38-0815315edafa" ]; fhir:Reference.type [ fhir:value "Patient" ]; fhir:Reference.display [ fhir:value "John Storm" ] ]; fhir:Observation.effectiveDateTime [ fhir:value "2016-12-15"^^xsd:date]; fhir:Observation.valueCodeableConcept [ fhir:CodeableConcept.coding [ fhir:index 0; fhir:Coding.system [ fhir:value "http://www.ebi.ac.uk/ipd/imgt/hla" ]; fhir:Coding.version [ fhir:value "3.23" ]; fhir:Coding.code [ fhir:value "HGG00041" ]; fhir:Coding.display [ fhir:value "HLA-B*15:01:01G" ] ] ]; fhir:Observation.method [ fhir:CodeableConcept.coding [ fhir:index 0; fhir:Coding.system [ fhir:value "http://www.ncbi.nlm.nih.gov/gtr/" ]; fhir:Coding.code [ fhir:value "GTR000000000.0" ] ]; fhir:CodeableConcept.text [ fhir:value "NGS based Class I HLA-A, -B, -C genotyping" ] ]; fhir:Observation.specimen [ fhir:Reference.reference [ fhir:value "urn:uuid:e44fbe33-6084-4ae2-a95e-8bc451c63340" ]; fhir:Reference.display [ fhir:value "buccal swab from John Storm" ] ]; fhir:Observation.derivedFrom [ fhir:index 0; fhir:Reference.reference [ fhir:value "urn:uuid:cbabf93e-1b4b-46f2-ba1e-d84862670670" ]; fhir:Reference.type [ fhir:value "MolecularSequence" ]; fhir:Reference.display [ fhir:value "HLA-B*15:01:01:01, exon 2" ] ], [ fhir:index 1; fhir:Reference.reference [ fhir:value "urn:uuid:c233ad3d-1572-48d6-93da-0a583535e138" ]; fhir:Reference.type [ fhir:value "MolecularSequence" ]; fhir:Reference.display [ fhir:value "HLA-B*15:01:01:01, exon 3" ] ]; fhir:Observation.component [ fhir:index 0; fhir:Observation.component.code [ fhir:CodeableConcept.coding [ fhir:index 0; a loinc:48018-6; fhir:Coding.system [ fhir:value "http://loinc.org" ]; fhir:Coding.code [ fhir:value "48018-6" ]; fhir:Coding.display [ fhir:value "Gene studied [ID]" ] ] ]; fhir:Observation.component.valueCodeableConcept [ fhir:CodeableConcept.coding [ fhir:index 0; fhir:Coding.system [ fhir:value "https://www.genenames.org/" ]; fhir:Coding.code [ fhir:value "HGNC:4932" ]; fhir:Coding.display [ fhir:value "HLA-B" ] ] ] ], [ fhir:index 1; fhir:Observation.component.code [ fhir:CodeableConcept.coding [ fhir:index 0; a loinc:81293-3; fhir:Coding.system [ fhir:value "http://loinc.org" ]; fhir:Coding.code [ fhir:value "81293-3" ]; fhir:Coding.display [ fhir:value "Description of ranges of DNA sequences examined" ] ] ]; fhir:Observation.component.valueCodeableConcept [ fhir:CodeableConcept.text [ fhir:value "Exons 2 and 3" ] ] ]. <urn:uuid:792be53e-d4fb-4887-a367-815ef6c706e5> a fhir:Observation; fhir:Resource.meta [ fhir:Meta.profile [ fhir:value "http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/obs-haplotype"; fhir:index 0; fhir:link <http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/obs-haplotype> ] ]; fhir:DomainResource.text [ fhir:Narrative.status [ fhir:value "generated" ]; fhir:Narrative.div "<div xmlns=\"http://www.w3.org/1999/xhtml\">\n <pre>HLA-B*57:01:01G</pre>\n </div>" ]; fhir:Observation.status [ fhir:value "final"]; fhir:Observation.category [ fhir:index 0; fhir:CodeableConcept.coding [ fhir:index 0; fhir:Coding.system [ fhir:value "http://terminology.hl7.org/CodeSystem/observation-category" ]; fhir:Coding.code [ fhir:value "laboratory" ] ] ]; fhir:Observation.code [ fhir:CodeableConcept.coding [ fhir:index 0; a loinc:84414-2; fhir:Coding.system [ fhir:value "http://loinc.org" ]; fhir:Coding.code [ fhir:value "84414-2" ]; fhir:Coding.display [ fhir:value "Haplotype name" ] ] ]; fhir:Observation.subject [ fhir:Reference.reference [ fhir:value "urn:uuid:13f34265-335c-4853-bc38-0815315edafa" ]; fhir:Reference.type [ fhir:value "Patient" ]; fhir:Reference.display [ fhir:value "John Storm" ] ]; fhir:Observation.effectiveDateTime [ fhir:value "2016-12-15"^^xsd:date]; fhir:Observation.valueCodeableConcept [ fhir:CodeableConcept.coding [ fhir:index 0; fhir:Coding.system [ fhir:value "http://www.ebi.ac.uk/ipd/imgt/hla" ]; fhir:Coding.version [ fhir:value "3.23" ]; fhir:Coding.code [ fhir:value "HLA-B*57:01:01G" ]; fhir:Coding.display [ fhir:value "HLA-B*57:01:01G" ] ] ]; fhir:Observation.method [ fhir:CodeableConcept.coding [ fhir:index 0; fhir:Coding.system [ fhir:value "http://www.ncbi.nlm.nih.gov/gtr/" ]; fhir:Coding.code [ fhir:value "GTR000000000.0" ] ]; fhir:CodeableConcept.text [ fhir:value "NGS based Class I HLA-A, -B, -C genotyping" ] ]; fhir:Observation.specimen [ fhir:Reference.reference [ fhir:value "urn:uuid:e44fbe33-6084-4ae2-a95e-8bc451c63340" ]; fhir:Reference.display [ fhir:value "buccal swab from John Storm" ] ]; fhir:Observation.derivedFrom [ fhir:index 0; fhir:Reference.reference [ fhir:value "urn:uuid:05fa52d7-5c67-460a-8722-d3460b24d6fe" ]; fhir:Reference.type [ fhir:value "MolecularSequence" ]; fhir:Reference.display [ fhir:value "HLA-B*57:01:01, exon 2" ] ], [ fhir:index 1; fhir:Reference.reference [ fhir:value "urn:uuid:db69e549-6267-4777-b4b9-8813f3329309" ]; fhir:Reference.type [ fhir:value "MolecularSequence" ]; fhir:Reference.display [ fhir:value "HLA-B*57:01:01, exon 3" ] ]; fhir:Observation.component [ fhir:index 0; fhir:Observation.component.code [ fhir:CodeableConcept.coding [ fhir:index 0; a loinc:48018-6; fhir:Coding.system [ fhir:value "http://loinc.org" ]; fhir:Coding.code [ fhir:value "48018-6" ]; fhir:Coding.display [ fhir:value "Gene studied [ID]" ] ] ]; fhir:Observation.component.valueCodeableConcept [ fhir:CodeableConcept.coding [ fhir:index 0; fhir:Coding.system [ fhir:value "https://www.genenames.org/" ]; fhir:Coding.code [ fhir:value "HGNC:4932" ]; fhir:Coding.display [ fhir:value "HLA-B" ] ] ] ]. <urn:uuid:60613a43-c4cb-4502-b3e2-cf9215feaa70> a fhir:Observation; fhir:Resource.meta [ fhir:Meta.profile [ fhir:value "http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/obs-genotype"; fhir:index 0; fhir:link <http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/obs-genotype> ] ]; fhir:DomainResource.text [ fhir:Narrative.status [ fhir:value "generated" ]; fhir:Narrative.div "<div xmlns=\"http://www.w3.org/1999/xhtml\">\n <pre>HLA-B*15:01:01G+HLA-B*57:01:01G</pre>\n </div>" ]; fhir:Observation.basedOn [ fhir:index 0; fhir:Reference.reference [ fhir:value "urn:uuid:99309303-045e-4cf4-90d7-250d7a7476ea" ]; fhir:Reference.type [ fhir:value "ServiceRequest" ]; fhir:Reference.display [ fhir:value "Class I HLA genotyping for John Storm" ] ]; fhir:Observation.status [ fhir:value "final"]; fhir:Observation.category [ fhir:index 0; fhir:CodeableConcept.coding [ fhir:index 0; fhir:Coding.system [ fhir:value "http://terminology.hl7.org/CodeSystem/observation-category" ]; fhir:Coding.code [ fhir:value "laboratory" ] ] ]; fhir:Observation.code [ fhir:CodeableConcept.coding [ fhir:index 0; a loinc:84413-4; fhir:Coding.system [ fhir:value "http://loinc.org" ]; fhir:Coding.code [ fhir:value "84413-4" ]; fhir:Coding.display [ fhir:value "Genotype display name" ] ] ]; fhir:Observation.subject [ fhir:Reference.reference [ fhir:value "urn:uuid:13f34265-335c-4853-bc38-0815315edafa" ]; fhir:Reference.type [ fhir:value "Patient" ]; fhir:Reference.display [ fhir:value "John Storm" ] ]; fhir:Observation.effectiveDateTime [ fhir:value "2016-12-15"^^xsd:date]; fhir:Observation.valueCodeableConcept [ fhir:CodeableConcept.coding [ fhir:index 0; fhir:Coding.system [ fhir:value "https://glstring.org" ]; fhir:Coding.version [ fhir:value "1.0" ]; fhir:Coding.code [ fhir:value "hla#3.23.0#HLA-B*15:01:01G+HLA-B*57:01:01G" ] ] ]; fhir:Observation.method [ fhir:CodeableConcept.coding [ fhir:index 0; fhir:Coding.system [ fhir:value "http://www.ncbi.nlm.nih.gov/gtr/" ]; fhir:Coding.code [ fhir:value "GTR000000000.0" ] ]; fhir:CodeableConcept.text [ fhir:value "NGS based Class I HLA-A, -B, -C genotyping" ] ]; fhir:Observation.specimen [ fhir:Reference.reference [ fhir:value "urn:uuid:e44fbe33-6084-4ae2-a95e-8bc451c63340" ]; fhir:Reference.display [ fhir:value "buccal swab from John Storm" ] ]; fhir:Observation.derivedFrom [ fhir:index 0; fhir:Reference.reference [ fhir:value "urn:uuid:e2092243-2970-49d2-a90f-b90d1d49715a" ]; fhir:Reference.type [ fhir:value "Observation" ]; fhir:Reference.display [ fhir:value "HLA-B*15:01:01G, exons 2 and 3" ] ], [ fhir:index 1; fhir:Reference.reference [ fhir:value "urn:uuid:792be53e-d4fb-4887-a367-815ef6c706e5" ]; fhir:Reference.type [ fhir:value "Observation" ]; fhir:Reference.display [ fhir:value "HLA-B*57:01:01G, exons 2 and 3" ] ]; fhir:Observation.component [ fhir:index 0; fhir:Observation.component.code [ fhir:CodeableConcept.coding [ fhir:index 0; a loinc:48018-6; fhir:Coding.system [ fhir:value "http://loinc.org" ]; fhir:Coding.code [ fhir:value "48018-6" ]; fhir:Coding.display [ fhir:value "Gene studied [ID]" ] ] ]; fhir:Observation.component.valueCodeableConcept [ fhir:CodeableConcept.coding [ fhir:index 0; fhir:Coding.system [ fhir:value "https://www.genenames.org/" ]; fhir:Coding.code [ fhir:value "HGNC:4932" ]; fhir:Coding.display [ fhir:value "HLA-B" ] ] ] ]. <urn:uuid:bb55c2bc-5ad2-4bc1-8ff3-c407d06b12d0> a fhir:MolecularSequence; fhir:DomainResource.text [ fhir:Narrative.status [ fhir:value "generated" ]; fhir:Narrative.div "<div xmlns=\"http://www.w3.org/1999/xhtml\">\n <pre>"HLA-C*01:02:01, exon 2"</pre>\n </div>" ]; fhir:MolecularSequence.type [ fhir:value "dna"]; fhir:MolecularSequence.coordinateSystem [ fhir:value "0"^^xsd:integer]; fhir:MolecularSequence.referenceSeq [ fhir:MolecularSequence.referenceSeq.referenceSeqId [ fhir:CodeableConcept.coding [ fhir:index 0; fhir:Coding.system [ fhir:value "http://www.ebi.ac.uk/ipd/imgt/hla" ]; fhir:Coding.version [ fhir:value "3.23" ]; fhir:Coding.code [ fhir:value "HLA00401" ] ]; fhir:CodeableConcept.text [ fhir:value "HLA-C*01:02:01" ] ]; fhir:MolecularSequence.referenceSeq.windowStart [ fhir:value "486"^^xsd:integer ]; fhir:MolecularSequence.referenceSeq.windowEnd [ fhir:value "756"^^xsd:integer ] ]; fhir:MolecularSequence.observedSeq [ fhir:value "GCTCCCACTCCATGAAGTATTTCTTCACATCCGTGTCCCGGCCTGGCCGCGGAGAGCCCCGCTTCATCTCAGTGGGCTACGTGGACGACACGCAGTTCGTGCGGTTCGACAGCGACGCCGCGAGTCCGAGAGGGGAGCCGCGGGCGCCGTGGGTGGAGCAGGAGGGGCCGGAGTATTGGGACCGGGAGACACAGAAGTACAAGCGCCAGGCACAGACTGACCGAGTGAGCCTGCGGAACCTGCGCGGCTACTACAACCAGAGCGAGGCCG"]. <urn:uuid:46938bb2-0486-4e87-bfd3-89aab2d5e22f> a fhir:MolecularSequence; fhir:DomainResource.text [ fhir:Narrative.status [ fhir:value "generated" ]; fhir:Narrative.div "<div xmlns=\"http://www.w3.org/1999/xhtml\">\n <pre>"HLA-C*01:02:01, exon 3"</pre>\n </div>" ]; fhir:MolecularSequence.type [ fhir:value "dna"]; fhir:MolecularSequence.coordinateSystem [ fhir:value "0"^^xsd:integer]; fhir:MolecularSequence.referenceSeq [ fhir:MolecularSequence.referenceSeq.referenceSeqId [ fhir:CodeableConcept.coding [ fhir:index 0; fhir:Coding.system [ fhir:value "http://www.ebi.ac.uk/ipd/imgt/hla" ]; fhir:Coding.version [ fhir:value "3.23" ]; fhir:Coding.code [ fhir:value "HLA00401" ] ]; fhir:CodeableConcept.text [ fhir:value "HLA-C*01:02:01" ] ]; fhir:MolecularSequence.referenceSeq.windowStart [ fhir:value "1002"^^xsd:integer ]; fhir:MolecularSequence.referenceSeq.windowEnd [ fhir:value "1278"^^xsd:integer ] ]; fhir:MolecularSequence.observedSeq [ fhir:value "GGTCTCACACCCTCCAGTGGATGTGTGGCTGCGACCTGGGGCCCGACGGGCGCCTCCTCCGCGGGTATGACCAGTACGCCTACGACGGCAAGGATTACATCGCCCTGAACGAGGACCTGCGCTCCTGGACCGCCGCGGACACCGCGGCTCAGATCACCCAGCGCAAGTGGGAGGCGGCCCGTGAGGCGGAGCAGCGGAGAGCCTACCTGGAGGGCACGTGCGTGGAGTGGCTCCGCAGATACCTGGAGAACGGGAAGGAGACGCTGCAGCGCGCGG"]. <urn:uuid:2ae2ff34-279e-43c2-9018-b054fd3fc1ce> a fhir:MolecularSequence; fhir:DomainResource.text [ fhir:Narrative.status [ fhir:value "generated" ]; fhir:Narrative.div "<div xmlns=\"http://www.w3.org/1999/xhtml\">\n <pre>"HLA-C*03:04:01:01, exon 2"</pre>\n </div>" ]; fhir:MolecularSequence.type [ fhir:value "dna"]; fhir:MolecularSequence.coordinateSystem [ fhir:value "0"^^xsd:integer]; fhir:MolecularSequence.referenceSeq [ fhir:MolecularSequence.referenceSeq.referenceSeqId [ fhir:CodeableConcept.coding [ fhir:index 0; fhir:Coding.system [ fhir:value "http://www.ebi.ac.uk/ipd/imgt/hla" ]; fhir:Coding.version [ fhir:value "3.23" ]; fhir:Coding.code [ fhir:value "HLA00413" ] ]; fhir:CodeableConcept.text [ fhir:value "HLA-C*03:04:01:01" ] ]; fhir:MolecularSequence.referenceSeq.windowStart [ fhir:value "486"^^xsd:integer ]; fhir:MolecularSequence.referenceSeq.windowEnd [ fhir:value "756"^^xsd:integer ] ]; fhir:MolecularSequence.observedSeq [ fhir:value "GCTCCCACTCCATGAGGTATTTCTACACCGCTGTGTCCCGGCCCGGCCGCGGGGAGCCCCACTTCATCGCAGTGGGCTACGTGGACGACACGCAGTTCGTGCGGTTCGACAGCGACGCCGCGAGTCCGAGAGGGGAGCCGCGGGCGCCGTGGGTGGAGCAGGAGGGGCCGGAGTATTGGGACCGGGAGACACAGAAGTACAAGCGCCAGGCACAGACTGACCGAGTGAGCCTGCGGAACCTGCGCGGCTACTACAACCAGAGCGAGGCCG"]. <urn:uuid:19153ef1-68c6-47a2-9676-c4eefbd39af9> a fhir:MolecularSequence; fhir:DomainResource.text [ fhir:Narrative.status [ fhir:value "generated" ]; fhir:Narrative.div "<div xmlns=\"http://www.w3.org/1999/xhtml\">\n <pre>"HLA-C*03:04:01:01, exon 3"</pre>\n </div>" ]; fhir:MolecularSequence.type [ fhir:value "dna"]; fhir:MolecularSequence.coordinateSystem [ fhir:value "0"^^xsd:integer]; fhir:MolecularSequence.referenceSeq [ fhir:MolecularSequence.referenceSeq.referenceSeqId [ fhir:CodeableConcept.coding [ fhir:index 0; fhir:Coding.system [ fhir:value "http://www.ebi.ac.uk/ipd/imgt/hla" ]; fhir:Coding.version [ fhir:value "3.23" ]; fhir:Coding.code [ fhir:value "HLA00413" ] ]; fhir:CodeableConcept.text [ fhir:value "HLA-C*03:04:01:01" ] ]; fhir:MolecularSequence.referenceSeq.windowStart [ fhir:value "1001"^^xsd:integer ]; fhir:MolecularSequence.referenceSeq.windowEnd [ fhir:value "1277"^^xsd:integer ] ]; fhir:MolecularSequence.observedSeq [ fhir:value "GGTCTCACATCATCCAGAGGATGTATGGCTGCGACGTGGGGCCCGACGGGCGCCTCCTCCGCGGGTATGACCAGTACGCCTACGACGGCAAGGATTACATCGCCCTGAACGAGGATCTGCGCTCCTGGACCGCCGCGGACACGGCGGCTCAGATCACCCAGCGCAAGTGGGAGGCGGCCCGTGAGGCGGAGCAGCTGAGAGCCTACCTGGAGGGCCTGTGCGTGGAGTGGCTCCGCAGATACCTGAAGAATGGGAAGGAGACGCTGCAGCGCGCGG"]. <urn:uuid:709c5315-9403-4867-9d82-0b953836665f> a fhir:Observation; fhir:Resource.meta [ fhir:Meta.profile [ fhir:value "http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/obs-haplotype"; fhir:index 0; fhir:link <http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/obs-haplotype> ] ]; fhir:DomainResource.text [ fhir:Narrative.status [ fhir:value "generated" ]; fhir:Narrative.div "<div xmlns=\"http://www.w3.org/1999/xhtml\">\n <pre>HLA-C*01:02:01G</pre>\n </div>" ]; fhir:Observation.status [ fhir:value "final"]; fhir:Observation.category [ fhir:index 0; fhir:CodeableConcept.coding [ fhir:index 0; fhir:Coding.system [ fhir:value "http://terminology.hl7.org/CodeSystem/observation-category" ]; fhir:Coding.code [ fhir:value "laboratory" ] ] ]; fhir:Observation.code [ fhir:CodeableConcept.coding [ fhir:index 0; a loinc:84414-2; fhir:Coding.system [ fhir:value "http://loinc.org" ]; fhir:Coding.code [ fhir:value "84414-2" ]; fhir:Coding.display [ fhir:value "Haplotype name" ] ] ]; fhir:Observation.subject [ fhir:Reference.reference [ fhir:value "urn:uuid:13f34265-335c-4853-bc38-0815315edafa" ]; fhir:Reference.type [ fhir:value "Patient" ]; fhir:Reference.display [ fhir:value "John Storm" ] ]; fhir:Observation.effectiveDateTime [ fhir:value "2016-12-15"^^xsd:date]; fhir:Observation.valueCodeableConcept [ fhir:CodeableConcept.coding [ fhir:index 0; fhir:Coding.system [ fhir:value "http://www.ebi.ac.uk/ipd/imgt/hla" ]; fhir:Coding.version [ fhir:value "3.23" ]; fhir:Coding.code [ fhir:value "HLA-C*01:02:01G" ]; fhir:Coding.display [ fhir:value "HLA-C*01:02:01G" ] ] ]; fhir:Observation.method [ fhir:CodeableConcept.coding [ fhir:index 0; fhir:Coding.system [ fhir:value "http://www.ncbi.nlm.nih.gov/gtr/" ]; fhir:Coding.code [ fhir:value "GTR000000000.0" ] ]; fhir:CodeableConcept.text [ fhir:value "NGS based Class I HLA-A, -B, -C genotyping" ] ]; fhir:Observation.specimen [ fhir:Reference.reference [ fhir:value "urn:uuid:e44fbe33-6084-4ae2-a95e-8bc451c63340" ]; fhir:Reference.display [ fhir:value "buccal swab from John Storm" ] ]; fhir:Observation.derivedFrom [ fhir:index 0; fhir:Reference.reference [ fhir:value "urn:uuid:bb55c2bc-5ad2-4bc1-8ff3-c407d06b12d0" ]; fhir:Reference.type [ fhir:value "MolecularSequence" ]; fhir:Reference.display [ fhir:value "HLA-C*01:02:01, exon 2" ] ], [ fhir:index 1; fhir:Reference.reference [ fhir:value "urn:uuid:46938bb2-0486-4e87-bfd3-89aab2d5e22f" ]; fhir:Reference.type [ fhir:value "MolecularSequence" ]; fhir:Reference.display [ fhir:value "HLA-C*01:02:01, exon 3" ] ]; fhir:Observation.component [ fhir:index 0; fhir:Observation.component.code [ fhir:CodeableConcept.coding [ fhir:index 0; a loinc:48018-6; fhir:Coding.system [ fhir:value "http://loinc.org" ]; fhir:Coding.code [ fhir:value "48018-6" ]; fhir:Coding.display [ fhir:value "Gene studied [ID]" ] ] ]; fhir:Observation.component.valueCodeableConcept [ fhir:CodeableConcept.coding [ fhir:index 0; fhir:Coding.system [ fhir:value "https://www.genenames.org/" ]; fhir:Coding.code [ fhir:value "HGNC:4933" ]; fhir:Coding.display [ fhir:value "HLA-C" ] ] ] ]. <urn:uuid:8b2aa21c-1426-4717-8ab0-a84d83df7d47> a fhir:Observation; fhir:Resource.meta [ fhir:Meta.profile [ fhir:value "http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/obs-haplotype"; fhir:index 0; fhir:link <http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/obs-haplotype> ] ]; fhir:DomainResource.text [ fhir:Narrative.status [ fhir:value "generated" ]; fhir:Narrative.div "<div xmlns=\"http://www.w3.org/1999/xhtml\">\n <pre>HLA-C*03:04:01G</pre>\n </div>" ]; fhir:Observation.status [ fhir:value "final"]; fhir:Observation.category [ fhir:index 0; fhir:CodeableConcept.coding [ fhir:index 0; fhir:Coding.system [ fhir:value "http://terminology.hl7.org/CodeSystem/observation-category" ]; fhir:Coding.code [ fhir:value "laboratory" ] ] ]; fhir:Observation.code [ fhir:CodeableConcept.coding [ fhir:index 0; a loinc:84414-2; fhir:Coding.system [ fhir:value "http://loinc.org" ]; fhir:Coding.code [ fhir:value "84414-2" ]; fhir:Coding.display [ fhir:value "Haplotype name" ] ] ]; fhir:Observation.subject [ fhir:Reference.reference [ fhir:value "urn:uuid:13f34265-335c-4853-bc38-0815315edafa" ]; fhir:Reference.type [ fhir:value "Patient" ]; fhir:Reference.display [ fhir:value "John Storm" ] ]; fhir:Observation.effectiveDateTime [ fhir:value "2016-12-15"^^xsd:date]; fhir:Observation.valueCodeableConcept [ fhir:CodeableConcept.coding [ fhir:index 0; fhir:Coding.system [ fhir:value "http://www.ebi.ac.uk/ipd/imgt/hla" ]; fhir:Coding.version [ fhir:value "3.23" ]; fhir:Coding.code [ fhir:value "HLA-C*01:02:01G" ]; fhir:Coding.display [ fhir:value "HLA-C*01:02:01G" ] ] ]; fhir:Observation.method [ fhir:CodeableConcept.coding [ fhir:index 0; fhir:Coding.system [ fhir:value "http://www.ncbi.nlm.nih.gov/gtr/" ]; fhir:Coding.code [ fhir:value "GTR000000000.0" ] ]; fhir:CodeableConcept.text [ fhir:value "NGS based Class I HLA-A, -B, -C genotyping" ] ]; fhir:Observation.specimen [ fhir:Reference.reference [ fhir:value "urn:uuid:e44fbe33-6084-4ae2-a95e-8bc451c63340" ]; fhir:Reference.display [ fhir:value "buccal swab from John Storm" ] ]; fhir:Observation.derivedFrom [ fhir:index 0; fhir:Reference.reference [ fhir:value "urn:uuid:2ae2ff34-279e-43c2-9018-b054fd3fc1ce" ]; fhir:Reference.type [ fhir:value "MolecularSequence" ]; fhir:Reference.display [ fhir:value "HLA-C*03:04:01:01, exon 2" ] ], [ fhir:index 1; fhir:Reference.reference [ fhir:value "urn:uuid:19153ef1-68c6-47a2-9676-c4eefbd39af9" ]; fhir:Reference.type [ fhir:value "MolecularSequence" ]; fhir:Reference.display [ fhir:value "HLA-C*03:04:01:01, exon 3" ] ]; fhir:Observation.component [ fhir:index 0; fhir:Observation.component.code [ fhir:CodeableConcept.coding [ fhir:index 0; a loinc:48018-6; fhir:Coding.system [ fhir:value "http://loinc.org" ]; fhir:Coding.code [ fhir:value "48018-6" ]; fhir:Coding.display [ fhir:value "Gene studied [ID]" ] ] ]; fhir:Observation.component.valueCodeableConcept [ fhir:CodeableConcept.coding [ fhir:index 0; fhir:Coding.system [ fhir:value "https://www.genenames.org/" ]; fhir:Coding.code [ fhir:value "HGNC:4933" ]; fhir:Coding.display [ fhir:value "HLA-C" ] ] ] ]. <urn:uuid:0e0a780e-4486-4cd0-bfae-7243c579f208> a fhir:Observation; fhir:Resource.meta [ fhir:Meta.profile [ fhir:value "http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/obs-genotype"; fhir:index 0; fhir:link <http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/obs-genotype> ] ]; fhir:DomainResource.text [ fhir:Narrative.status [ fhir:value "generated" ]; fhir:Narrative.div "<div xmlns=\"http://www.w3.org/1999/xhtml\">\n <pre>HLA-C*01:02:01G+HLA-C*03:04:01G</pre>\n </div>" ]; fhir:Observation.basedOn [ fhir:index 0; fhir:Reference.reference [ fhir:value "urn:uuid:99309303-045e-4cf4-90d7-250d7a7476ea" ]; fhir:Reference.type [ fhir:value "ServiceRequest" ]; fhir:Reference.display [ fhir:value "Class I HLA genotyping for John Storm" ] ]; fhir:Observation.status [ fhir:value "final"]; fhir:Observation.category [ fhir:index 0; fhir:CodeableConcept.coding [ fhir:index 0; fhir:Coding.system [ fhir:value "http://terminology.hl7.org/CodeSystem/observation-category" ]; fhir:Coding.code [ fhir:value "laboratory" ] ] ]; fhir:Observation.code [ fhir:CodeableConcept.coding [ fhir:index 0; a loinc:84413-4; fhir:Coding.system [ fhir:value "http://loinc.org" ]; fhir:Coding.code [ fhir:value "84413-4" ]; fhir:Coding.display [ fhir:value "Genotype display name" ] ] ]; fhir:Observation.subject [ fhir:Reference.reference [ fhir:value "urn:uuid:13f34265-335c-4853-bc38-0815315edafa" ]; fhir:Reference.type [ fhir:value "Patient" ]; fhir:Reference.display [ fhir:value "John Storm" ] ]; fhir:Observation.effectiveDateTime [ fhir:value "2016-12-15"^^xsd:date]; fhir:Observation.valueCodeableConcept [ fhir:CodeableConcept.coding [ fhir:index 0; fhir:Coding.system [ fhir:value "https://glstring.org" ]; fhir:Coding.version [ fhir:value "1.0" ]; fhir:Coding.code [ fhir:value "hla#3.23.0#HLA-C*01:02:01G+HLA-C*03:04:01G" ] ] ]; fhir:Observation.method [ fhir:CodeableConcept.coding [ fhir:index 0; fhir:Coding.system [ fhir:value "http://www.ncbi.nlm.nih.gov/gtr/" ]; fhir:Coding.code [ fhir:value "GTR000000000.0" ] ]; fhir:CodeableConcept.text [ fhir:value "NGS based Class I HLA-A, -B, -C genotyping" ] ]; fhir:Observation.specimen [ fhir:Reference.reference [ fhir:value "urn:uuid:e44fbe33-6084-4ae2-a95e-8bc451c63340" ]; fhir:Reference.display [ fhir:value "buccal swab from John Storm" ] ]; fhir:Observation.derivedFrom [ fhir:index 0; fhir:Reference.reference [ fhir:value "urn:uuid:8b2aa21c-1426-4717-8ab0-a84d83df7d47" ]; fhir:Reference.type [ fhir:value "Observation" ]; fhir:Reference.display [ fhir:value "HLA-C*03:04:01G, exons 2 and 3" ] ], [ fhir:index 1; fhir:Reference.reference [ fhir:value "urn:uuid:709c5315-9403-4867-9d82-0b953836665f" ]; fhir:Reference.type [ fhir:value "Observation" ]; fhir:Reference.display [ fhir:value "HLA-C*01:02:01G, exons 2 and 3" ] ]; fhir:Observation.component [ fhir:index 0; fhir:Observation.component.code [ fhir:CodeableConcept.coding [ fhir:index 0; a loinc:48018-6; fhir:Coding.system [ fhir:value "http://loinc.org" ]; fhir:Coding.code [ fhir:value "48018-6" ]; fhir:Coding.display [ fhir:value "Gene studied [ID]" ] ] ]; fhir:Observation.component.valueCodeableConcept [ fhir:CodeableConcept.coding [ fhir:index 0; fhir:Coding.system [ fhir:value "https://www.genenames.org/" ]; fhir:Coding.code [ fhir:value "HGNC:4933" ]; fhir:Coding.display [ fhir:value "HLA-C" ] ] ] ], [ fhir:index 1; fhir:Observation.component.code [ fhir:CodeableConcept.coding [ fhir:index 0; a loinc:81293-3; fhir:Coding.system [ fhir:value "http://loinc.org" ]; fhir:Coding.code [ fhir:value "81293-3" ]; fhir:Coding.display [ fhir:value "Description of ranges of DNA sequences examined" ] ] ]; fhir:Observation.component.valueCodeableConcept [ fhir:CodeableConcept.text [ fhir:value "Exons 2 and 3" ] ] ]. <urn:uuid:b0a4b18e-94e7-4b1b-8031-c7ae4bdd8db9> a fhir:DiagnosticReport; fhir:Resource.meta [ fhir:Meta.profile [ fhir:value "http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/diagnosticreport"; fhir:index 0; fhir:link <http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/diagnosticreport> ] ]; fhir:DomainResource.text [ fhir:Narrative.status [ fhir:value "generated" ]; fhir:Narrative.div "<div xmlns=\"http://www.w3.org/1999/xhtml\">\n <pre>\nHLA-A,-B,-C genotyping report for John Storm (MRN:12345)\n\nLOCUS ALLELE 1 ALLELE 2\nHLA-A HLA-A:01:01G HLA-A*01:02\nHLA-B HLA-B*15:01:01G HLA-B*57:01:01G\nHLA-C HLA-C*01:02:01G HLA-C*03:04:01G\n\nAllele assignments based on IMGT/HLA 3.23\nEffective date: 2015-12-15\nMethod: Sequencing of exons 2 and 3 of HLA Class I genes\nLab: aTypingLab Inc\n </pre>\n </div>" ]; fhir:DomainResource.extension [ fhir:index 0; fhir:Extension.url [ fhir:value "http://hl7.org/fhir/StructureDefinition/hla-genotyping-resultsAlleleDatabase" ]; fhir:Extension.valueCodeableConcept [ fhir:CodeableConcept.coding [ fhir:index 0; fhir:Coding.system [ fhir:value "http://www.ebi.ac.uk/ipd/imgt/hla" ]; fhir:Coding.version [ fhir:value "3.23" ] ] ] ], [ fhir:index 1; fhir:Extension.url [ fhir:value "http://hl7.org/fhir/StructureDefinition/hla-genotyping-resultsGlstring" ]; fhir:Element.extension [ fhir:index 0; fhir:Extension.url [ fhir:value "text" ]; fhir:Extension.valueString [ fhir:value "HLA-A*01:01:01G+HLA-A*01:02^HLA-B*15:01:01G+HLA-B*57:01:01G^HLA-C*01:02:01G+HLA-C*03:04:01G" ] ], [ fhir:index 1; fhir:Extension.url [ fhir:value "uri" ]; fhir:Extension.valueUri [ fhir:value "https://gl.nmdp.org/imgt-hla/3.23.0/multilocus-unphased-genotype/ex" ] ] ]; fhir:DiagnosticReport.basedOn [ fhir:index 0; fhir:Reference.reference [ fhir:value "urn:uuid:99309303-045e-4cf4-90d7-250d7a7476ea" ]; fhir:Reference.type [ fhir:value "ServiceRequest" ]; fhir:Reference.display [ fhir:value "Class I HLA genotyping for John Storm" ] ]; fhir:DiagnosticReport.status [ fhir:value "final"]; fhir:DiagnosticReport.category [ fhir:index 0; fhir:CodeableConcept.coding [ fhir:index 0; fhir:Coding.system [ fhir:value "http://terminology.hl7.org/CodeSystem/v2-0074" ]; fhir:Coding.code [ fhir:value "GE" ]; fhir:Coding.display [ fhir:value "Genetics" ] ] ]; fhir:DiagnosticReport.code [ fhir:CodeableConcept.coding [ fhir:index 0; a loinc:81247-9; fhir:Coding.system [ fhir:value "http://loinc.org" ]; fhir:Coding.code [ fhir:value "81247-9" ]; fhir:Coding.display [ fhir:value "Master HL7 genetic variant reporting panel" ] ] ]; fhir:DiagnosticReport.subject [ fhir:Reference.reference [ fhir:value "urn:uuid:13f34265-335c-4853-bc38-0815315edafa" ]; fhir:Reference.type [ fhir:value "Patient" ]; fhir:Reference.display [ fhir:value "John Storm" ] ]; fhir:DiagnosticReport.effectiveDateTime [ fhir:value "2016-12-15"^^xsd:date]; fhir:DiagnosticReport.issued [ fhir:value "2016-12-15T14:15:30-06:00"^^xsd:dateTime]; fhir:DiagnosticReport.performer [ fhir:index 0; fhir:Reference.reference [ fhir:value "urn:uuid:9243cc20-27bd-4f87-ba90-0328ed474950" ]; fhir:Reference.type [ fhir:value "Organization" ]; fhir:Reference.display [ fhir:value "aTypingLab Inc" ] ]; fhir:DiagnosticReport.specimen [ fhir:index 0; fhir:Reference.reference [ fhir:value "urn:uuid:e44fbe33-6084-4ae2-a95e-8bc451c63340" ]; fhir:Reference.display [ fhir:value "buccal swab from John Storm" ] ]; fhir:DiagnosticReport.result [ fhir:index 0; fhir:Reference.reference [ fhir:value "urn:uuid:49a86246-4004-42eb-9bdc-f542f93f9228" ]; fhir:Reference.type [ fhir:value "Observation" ]; fhir:Reference.display [ fhir:value "HLA-A: HLA-A:01:01:01G+HLA-A*01:02" ] ], [ fhir:index 1; fhir:Reference.reference [ fhir:value "urn:uuid:60613a43-c4cb-4502-b3e2-cf9215feaa70" ]; fhir:Reference.type [ fhir:value "Observation" ]; fhir:Reference.display [ fhir:value "HLA-B: HLA-B*15:01:01G+HLA-B*57:01:01G" ] ], [ fhir:index 2; fhir:Reference.reference [ fhir:value "urn:uuid:0e0a780e-4486-4cd0-bfae-7243c579f208" ]; fhir:Reference.type [ fhir:value "Observation" ]; fhir:Reference.display [ fhir:value "HLA-C: HLA-C*01:02:01G+HLA-C*03:04:01G" ] ]. # - ontology header ------------------------------------------------------------ a owl:Ontology; owl:imports fhir:fhir.ttl.